Incidental Mutation 'R8004:Dpp4'
ID616491
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62358828 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 453 (V453A)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably benign
Transcript: ENSMUST00000047812
AA Change: V453A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: V453A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,951,062 probably benign Het
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nfkb1 C A 3: 135,591,551 probably benign Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
Rbm44 T A 1: 91,152,158 probably benign Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R3765:Dpp4 UTSW 2 62386436 missense probably benign 0.17
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGGGCTCCTATGTTGCCAAAG -3'
(R):5'- GAAAATTCCTGGTGGGTTGC -3'

Sequencing Primer
(F):5'- CTCCTATGTTGCCAAAGGAAGAAG -3'
(R):5'- GCTATGGTGGTCTGACTCCTC -3'
Posted On2020-01-23