Incidental Mutation 'R8004:Sp3'
ID616493
Institutional Source Beutler Lab
Gene Symbol Sp3
Ensembl Gene ENSMUSG00000027109
Gene Nametrans-acting transcription factor 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location72936427-72980446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72970208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 531 (I531K)
Ref Sequence ENSEMBL: ENSMUSP00000099750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066003] [ENSMUST00000102689] [ENSMUST00000112062]
Predicted Effect probably benign
Transcript: ENSMUST00000066003
AA Change: I487K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065807
Gene: ENSMUSG00000027109
AA Change: I487K

DomainStartEndE-ValueType
low complexity region 14 59 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
low complexity region 231 241 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 425 448 N/A INTRINSIC
ZnF_C2H2 579 603 1.86e0 SMART
ZnF_C2H2 609 633 7.37e-4 SMART
ZnF_C2H2 639 661 5.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102689
AA Change: I531K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099750
Gene: ENSMUSG00000027109
AA Change: I531K

DomainStartEndE-ValueType
low complexity region 20 51 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
low complexity region 469 492 N/A INTRINSIC
ZnF_C2H2 623 647 1.86e0 SMART
ZnF_C2H2 653 677 7.37e-4 SMART
ZnF_C2H2 683 705 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112062
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene product belongs to a family of Sp1 related transcription factors, which regulate transcription by binding to consensus GC- and GT-box regulatory elements in target genes. This protein contains a zinc finger DNA-binding domain and several transactivation domains, and has been reported to function as a bifunctional transcription factor that either stimulates or represses transcription of numerous genes. Alternative splicing results in transcript variants encoding different isoforms, and one variant initiates translation from a non-AUG (AUA) codon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a reduced birth body size, skeletal, tooth and hematopoietic defects, and die shortly after birth due to respiratory failure. Homozygous mutant mice bearing a subtle point mutation in the SUMO attachment site show loss of DNAmethylation in sumoylation-deficient MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,951,062 probably benign Het
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nfkb1 C A 3: 135,591,551 probably benign Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
Rbm44 T A 1: 91,152,158 probably benign Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Sp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Sp3 APN 2 72938062 utr 3 prime probably benign
IGL02457:Sp3 APN 2 72971469 missense probably damaging 1.00
R0417:Sp3 UTSW 2 72971501 missense possibly damaging 0.57
R0539:Sp3 UTSW 2 72970532 missense possibly damaging 0.90
R0685:Sp3 UTSW 2 72970998 missense probably damaging 1.00
R1435:Sp3 UTSW 2 72938156 missense possibly damaging 0.86
R1731:Sp3 UTSW 2 72946655 missense probably damaging 0.98
R1838:Sp3 UTSW 2 72938176 missense possibly damaging 0.66
R2283:Sp3 UTSW 2 72971177 missense possibly damaging 0.95
R3892:Sp3 UTSW 2 72979032 intron probably benign
R4508:Sp3 UTSW 2 72970397 missense probably damaging 1.00
R4668:Sp3 UTSW 2 72970981 missense probably damaging 1.00
R4896:Sp3 UTSW 2 72938289 missense probably benign 0.18
R5004:Sp3 UTSW 2 72938289 missense probably benign 0.18
R5381:Sp3 UTSW 2 72970566 missense probably benign 0.17
R5493:Sp3 UTSW 2 72938122 missense probably damaging 1.00
R5691:Sp3 UTSW 2 72971459 missense probably damaging 1.00
R5755:Sp3 UTSW 2 72938381 splice site silent
R6364:Sp3 UTSW 2 72970941 missense probably benign 0.00
R6640:Sp3 UTSW 2 72971114 missense possibly damaging 0.61
R7197:Sp3 UTSW 2 72979609 missense probably benign 0.08
Z1176:Sp3 UTSW 2 72970167 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCCTGATAGTTGATAGTACCGATC -3'
(R):5'- GGTCCAGAACTTACAGAATTTGC -3'

Sequencing Primer
(F):5'- TGATAGTTGATAGTACCGATCAGATG -3'
(R):5'- TTTGCAAATACAAAATACTGCTGCCC -3'
Posted On2020-01-23