Incidental Mutation 'R8004:Fam69a'
ID616505
Institutional Source Beutler Lab
Gene Symbol Fam69a
Ensembl Gene ENSMUSG00000029270
Gene Namefamily with sequence similarity 69, member A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location107908053-107987085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107909666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000031198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000145239] [ENSMUST00000153172] [ENSMUST00000153590]
Predicted Effect probably damaging
Transcript: ENSMUST00000031198
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270
AA Change: D342G

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082223
SMART Domains Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
Pfam:Ribosomal_L18p 26 173 2.1e-46 PFAM
Pfam:Ribosomal_L18_c 192 283 2.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145239
SMART Domains Protein: ENSMUSP00000117801
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 1 132 1.18e-45 SMART
Pfam:PIP49_C 149 284 2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153172
SMART Domains Protein: ENSMUSP00000114892
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 24 87 1.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153590
SMART Domains Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
Pfam:Ribosomal_L18p 1 123 6.3e-37 PFAM
Pfam:Ribosomal_L18_c 142 163 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Fam69a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Fam69a APN 5 107911781 missense probably benign 0.24
R1799:Fam69a UTSW 5 107909847 missense probably damaging 0.98
R2048:Fam69a UTSW 5 107910020 missense probably damaging 0.98
R2169:Fam69a UTSW 5 107909459 nonsense probably null
R2408:Fam69a UTSW 5 107914425 missense possibly damaging 0.90
R3085:Fam69a UTSW 5 107914424 missense probably damaging 1.00
R4446:Fam69a UTSW 5 107924634 missense probably damaging 1.00
R4654:Fam69a UTSW 5 107910116 unclassified probably null
R4979:Fam69a UTSW 5 107909534 nonsense probably null
R5405:Fam69a UTSW 5 107909961 missense probably benign 0.00
R5482:Fam69a UTSW 5 107909663 missense probably damaging 1.00
R6397:Fam69a UTSW 5 107911638 nonsense probably null
R7006:Fam69a UTSW 5 107910161 missense probably benign 0.01
R7465:Fam69a UTSW 5 107909684 missense probably damaging 1.00
X0013:Fam69a UTSW 5 107909847 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGTGACTTTGAGAGCAATACAAG -3'
(R):5'- ACCATCATGGCCCAGAAAGG -3'

Sequencing Primer
(F):5'- CTTTGAGAGCAATACAAGAATAAAGC -3'
(R):5'- GTTTTCCATGGCCCCTATGGAAAC -3'
Posted On2020-01-23