Incidental Mutation 'R8004:Chrm2'
ID616509
Institutional Source Beutler Lab
Gene Symbol Chrm2
Ensembl Gene ENSMUSG00000045613
Gene Namecholinergic receptor, muscarinic 2, cardiac
Synonymsmuscarinic acetylcholine receptor 2, M2, Chrm-2, AChR M2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location36388084-36528414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36523286 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 26 (I26N)
Ref Sequence ENSEMBL: ENSMUSP00000130874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172278]
Predicted Effect probably damaging
Transcript: ENSMUST00000172278
AA Change: I26N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130874
Gene: ENSMUSG00000045613
AA Change: I26N

DomainStartEndE-ValueType
Pfam:7tm_1 40 440 2.5e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have slightly decreased body weight (5%) compared to wild-type animals and are resistant to the tremorogenic, analgesic, and hypothermic responses to oxotremorine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Chrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Chrm2 APN 6 36523391 missense probably damaging 1.00
IGL00495:Chrm2 APN 6 36523420 missense possibly damaging 0.61
IGL01011:Chrm2 APN 6 36524438 missense probably benign 0.41
IGL01482:Chrm2 APN 6 36523757 missense possibly damaging 0.95
R0101:Chrm2 UTSW 6 36524495 missense probably damaging 1.00
R0390:Chrm2 UTSW 6 36524111 missense probably benign 0.06
R0539:Chrm2 UTSW 6 36523706 missense possibly damaging 0.69
R0972:Chrm2 UTSW 6 36524466 missense possibly damaging 0.56
R2106:Chrm2 UTSW 6 36523447 missense probably damaging 1.00
R3552:Chrm2 UTSW 6 36523810 missense probably damaging 1.00
R4431:Chrm2 UTSW 6 36524162 missense probably benign
R4910:Chrm2 UTSW 6 36524233 missense probably benign 0.19
R5358:Chrm2 UTSW 6 36523355 missense probably damaging 1.00
R5846:Chrm2 UTSW 6 36523450 missense probably damaging 0.98
R6108:Chrm2 UTSW 6 36523295 missense probably damaging 1.00
R6418:Chrm2 UTSW 6 36523739 missense probably damaging 1.00
R6628:Chrm2 UTSW 6 36523357 missense probably damaging 1.00
R6677:Chrm2 UTSW 6 36524092 missense probably damaging 0.99
R6716:Chrm2 UTSW 6 36524435 missense probably damaging 1.00
R7658:Chrm2 UTSW 6 36523249 missense probably benign 0.00
Z1177:Chrm2 UTSW 6 36524607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGGACTGGGAAGTTTTCC -3'
(R):5'- CCAGTAGCCAATCACAGTGTAG -3'

Sequencing Primer
(F):5'- GCCACTTGACTACTGAAC -3'
(R):5'- TCACAGTGTAGAGGGTATACAAGTTC -3'
Posted On2020-01-23