Incidental Mutation 'R8004:Cyp2b23'
ID616515
Institutional Source Beutler Lab
Gene Symbol Cyp2b23
Ensembl Gene ENSMUSG00000040650
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 23
SynonymsEG243881
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26665227-26686437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26679466 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 191 (T191K)
Ref Sequence ENSEMBL: ENSMUSP00000076578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077356]
Predicted Effect probably benign
Transcript: ENSMUST00000077356
AA Change: T191K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076578
Gene: ENSMUSG00000040650
AA Change: T191K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Cyp2b23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Cyp2b23 APN 7 26679490 missense probably damaging 0.98
IGL01879:Cyp2b23 APN 7 26672854 missense probably benign 0.04
IGL02207:Cyp2b23 APN 7 26681755 missense probably damaging 1.00
IGL03047:Cyp2b23 APN 7 26681467 splice site probably benign
R0117:Cyp2b23 UTSW 7 26673114 missense probably benign 0.25
R0265:Cyp2b23 UTSW 7 26672879 splice site probably benign
R1457:Cyp2b23 UTSW 7 26673149 missense probably damaging 1.00
R1605:Cyp2b23 UTSW 7 26686418 missense probably benign 0.02
R1639:Cyp2b23 UTSW 7 26686417 missense possibly damaging 0.77
R1741:Cyp2b23 UTSW 7 26673077 missense possibly damaging 0.94
R2042:Cyp2b23 UTSW 7 26666108 missense probably damaging 1.00
R3911:Cyp2b23 UTSW 7 26681417 missense probably benign 0.02
R4078:Cyp2b23 UTSW 7 26673092 missense probably damaging 1.00
R4279:Cyp2b23 UTSW 7 26666027 missense possibly damaging 0.89
R4668:Cyp2b23 UTSW 7 26672734 missense probably damaging 1.00
R5419:Cyp2b23 UTSW 7 26681423 nonsense probably null
R5516:Cyp2b23 UTSW 7 26673057 nonsense probably null
R5723:Cyp2b23 UTSW 7 26681396 missense probably benign 0.41
R5873:Cyp2b23 UTSW 7 26675006 missense probably benign 0.02
R6346:Cyp2b23 UTSW 7 26681725 missense probably damaging 0.98
R6977:Cyp2b23 UTSW 7 26681320 missense possibly damaging 0.87
R7131:Cyp2b23 UTSW 7 26681413 missense probably benign 0.25
R7181:Cyp2b23 UTSW 7 26674403 missense probably damaging 1.00
R7715:Cyp2b23 UTSW 7 26681695 missense probably benign
R7877:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R7880:Cyp2b23 UTSW 7 26673134 missense probably damaging 1.00
R7960:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R7963:Cyp2b23 UTSW 7 26673134 missense probably damaging 1.00
R8072:Cyp2b23 UTSW 7 26666006 missense probably damaging 1.00
R8083:Cyp2b23 UTSW 7 26686403 missense possibly damaging 0.62
Z1088:Cyp2b23 UTSW 7 26681411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGTCTCAGCCTCCTTGTATTG -3'
(R):5'- CAAATGGGTTAGCAGGTGTTTC -3'

Sequencing Primer
(F):5'- AGCCTCCTTGTATTGCCACATTG -3'
(R):5'- AGCAGGTGTTTCTAACATTTGAG -3'
Posted On2020-01-23