Incidental Mutation 'R8004:Nfatc2ip'
ID616516
Institutional Source Beutler Lab
Gene Symbol Nfatc2ip
Ensembl Gene ENSMUSG00000030722
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
SynonymsNIP45, D7Ertd304e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126382854-126396737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126390405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000075094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075671]
PDB Structure
The crystal structure of SUMO-like domain 2 in Nip45 [X-RAY DIFFRACTION]
The crystal structure of the SLD2:Ubc9 complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075671
AA Change: V269A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075094
Gene: ENSMUSG00000030722
AA Change: V269A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
coiled coil region 199 227 N/A INTRINSIC
UBQ 258 328 1.31e-8 SMART
low complexity region 329 338 N/A INTRINSIC
Pfam:Rad60-SLD 341 411 3.6e-14 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display profound defects in the expression of NFAT-regulated cytokine genes and defects in the efficient handling of parasites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Nfatc2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Nfatc2ip APN 7 126390564 unclassified probably null
IGL03137:Nfatc2ip APN 7 126390568 missense possibly damaging 0.77
Weissgott UTSW 7 126396010 missense possibly damaging 0.80
R0136:Nfatc2ip UTSW 7 126391335 missense probably benign 0.11
R0521:Nfatc2ip UTSW 7 126396579 missense possibly damaging 0.93
R0657:Nfatc2ip UTSW 7 126391335 missense probably benign 0.11
R1610:Nfatc2ip UTSW 7 126387407 missense probably damaging 0.99
R1768:Nfatc2ip UTSW 7 126390462 missense probably benign 0.00
R1932:Nfatc2ip UTSW 7 126384992 missense probably damaging 1.00
R2116:Nfatc2ip UTSW 7 126385108 missense probably damaging 1.00
R2130:Nfatc2ip UTSW 7 126390462 missense probably benign 0.00
R2202:Nfatc2ip UTSW 7 126391295 missense probably benign 0.01
R2350:Nfatc2ip UTSW 7 126395998 missense probably benign 0.30
R4946:Nfatc2ip UTSW 7 126396612 missense possibly damaging 0.79
R5545:Nfatc2ip UTSW 7 126390470 missense possibly damaging 0.86
R6229:Nfatc2ip UTSW 7 126395941 critical splice donor site probably null
R6460:Nfatc2ip UTSW 7 126387737 missense probably damaging 1.00
R6741:Nfatc2ip UTSW 7 126396010 missense possibly damaging 0.80
R7355:Nfatc2ip UTSW 7 126387611 critical splice donor site probably null
R7912:Nfatc2ip UTSW 7 126390445 nonsense probably null
R7993:Nfatc2ip UTSW 7 126390445 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATATGCCTAAGAAGCCTTGAAAG -3'
(R):5'- TGTCTTGTCCATACCCAGGGAAG -3'

Sequencing Primer
(F):5'- GCCTTGAAAGATGGGTAAATTTTGCC -3'
(R):5'- TTGTCCATACCCAGGGAAGTGAAC -3'
Posted On2020-01-23