Incidental Mutation 'R8004:Pcsk4'
ID616527
Institutional Source Beutler Lab
Gene Symbol Pcsk4
Ensembl Gene ENSMUSG00000020131
Gene Nameproprotein convertase subtilisin/kexin type 4
SynonymsPC4, SPC5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80321283-80329498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80322840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 526 (D526G)
Ref Sequence ENSEMBL: ENSMUSP00000020340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000020341] [ENSMUST00000020349] [ENSMUST00000105359] [ENSMUST00000128653] [ENSMUST00000135071]
Predicted Effect probably damaging
Transcript: ENSMUST00000020340
AA Change: D526G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131
AA Change: D526G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020349
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105359
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
PHENOTYPE: Inactivation of this locus results in significantly reduced male fertility, putatively due to impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,951,062 probably benign Het
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nfkb1 C A 3: 135,591,551 probably benign Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
Rbm44 T A 1: 91,152,158 probably benign Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Pcsk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pcsk4 APN 10 80322823 missense probably damaging 1.00
IGL02818:Pcsk4 APN 10 80322792 missense probably damaging 0.98
IGL03115:Pcsk4 APN 10 80329049 missense probably damaging 1.00
IGL03354:Pcsk4 APN 10 80326059 missense probably damaging 0.99
R0538:Pcsk4 UTSW 10 80325334 missense probably damaging 1.00
R0760:Pcsk4 UTSW 10 80325941 unclassified probably benign
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1554:Pcsk4 UTSW 10 80321951 missense probably benign 0.01
R1728:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1784:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1886:Pcsk4 UTSW 10 80328960 missense probably benign 0.32
R1981:Pcsk4 UTSW 10 80325779 missense probably damaging 1.00
R2090:Pcsk4 UTSW 10 80325821 missense probably benign 0.02
R2125:Pcsk4 UTSW 10 80323879 missense probably benign 0.32
R2283:Pcsk4 UTSW 10 80322750 missense probably damaging 1.00
R4183:Pcsk4 UTSW 10 80325011 missense probably benign 0.12
R4283:Pcsk4 UTSW 10 80329453 unclassified probably benign
R4798:Pcsk4 UTSW 10 80323104 missense probably damaging 1.00
R4857:Pcsk4 UTSW 10 80325039 missense probably damaging 1.00
R4990:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R4991:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R5020:Pcsk4 UTSW 10 80326035 missense probably benign 0.00
R5123:Pcsk4 UTSW 10 80322145 missense probably null 0.56
R5354:Pcsk4 UTSW 10 80323689 missense probably damaging 0.98
R6077:Pcsk4 UTSW 10 80326239 missense probably damaging 0.99
R6102:Pcsk4 UTSW 10 80325817 nonsense probably null
R6250:Pcsk4 UTSW 10 80325592 missense probably benign 0.04
R6378:Pcsk4 UTSW 10 80328975 missense probably benign 0.34
R6729:Pcsk4 UTSW 10 80325101 missense probably damaging 0.99
R7308:Pcsk4 UTSW 10 80323173 missense probably benign 0.41
R7595:Pcsk4 UTSW 10 80322101 missense possibly damaging 0.84
Z1176:Pcsk4 UTSW 10 80322726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTAGGATCCTCTATGGCTGAG -3'
(R):5'- TGGAGATCTTCCTCACCAGC -3'

Sequencing Primer
(F):5'- ATCCTCTATGGCTGAGGGTCAAC -3'
(R):5'- TCCTCACCAGCCCCATGG -3'
Posted On2020-01-23