Incidental Mutation 'R8004:Tjp2'
ID616544
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24114120 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 559 (P559L)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure
Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000099558
AA Change: P559L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: P559L

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
PIT4402001:Tjp2 UTSW 19 24098129 nonsense probably null
R0032:Tjp2 UTSW 19 24108695 missense probably damaging 1.00
R0667:Tjp2 UTSW 19 24108749 missense probably benign 0.36
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1571:Tjp2 UTSW 19 24100875 missense probably damaging 1.00
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1658:Tjp2 UTSW 19 24112947 missense probably damaging 0.99
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4077:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 intron probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 intron probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense probably benign 0.40
R7514:Tjp2 UTSW 19 24111522 missense probably benign 0.03
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Z1176:Tjp2 UTSW 19 24131365 missense probably benign 0.00
Z1177:Tjp2 UTSW 19 24095460 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGCTATCTCGGTAGTTGGAAGG -3'
(R):5'- GTAACCACTGAGTAATTTCCCCTG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GAGTAATTTCCCCTGTGTCATCAG -3'
Posted On2020-01-23