Incidental Mutation 'R8005:Ly75'
ID 616550
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission 046045-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8005 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60163278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 804 (Y804N)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: Y804N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: Y804N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: Y804N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: Y804N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,063,774 (GRCm39) D294G probably benign Het
Ak8 A T 2: 28,602,314 (GRCm39) S83C probably benign Het
Ankrd34b C A 13: 92,575,230 (GRCm39) A154E possibly damaging Het
Anks1 A G 17: 28,278,341 (GRCm39) D1175G probably damaging Het
Ano4 T A 10: 88,807,183 (GRCm39) L799F probably benign Het
Aplp1 T C 7: 30,135,470 (GRCm39) probably null Het
Apob A T 12: 8,059,744 (GRCm39) H2742L probably benign Het
Apol7e C T 15: 77,602,277 (GRCm39) Q292* probably null Het
Atp2b1 G A 10: 98,830,661 (GRCm39) G374D probably damaging Het
B4galt5 A G 2: 167,143,384 (GRCm39) S347P probably damaging Het
Bcl11b T C 12: 107,882,456 (GRCm39) T620A probably benign Het
Bco2 T A 9: 50,450,213 (GRCm39) D329V probably damaging Het
Cd200l2 T C 16: 45,352,400 (GRCm39) probably benign Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Copg2 T A 6: 30,873,632 (GRCm39) M1L possibly damaging Het
D430041D05Rik G A 2: 104,088,599 (GRCm39) H164Y possibly damaging Het
Dscaml1 G T 9: 45,628,808 (GRCm39) G1121C probably damaging Het
Gas2l1 A T 11: 5,011,552 (GRCm39) S426T probably benign Het
Gm9195 T A 14: 72,663,840 (GRCm39) I2740F probably benign Het
Irgm1 A G 11: 48,757,217 (GRCm39) I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 (GRCm39) T343I probably damaging Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Mgat2 A G 12: 69,232,722 (GRCm39) H432R probably damaging Het
Nsrp1 A T 11: 76,936,612 (GRCm39) M528K probably damaging Het
Nup54 T C 5: 92,576,006 (GRCm39) I162V probably benign Het
Obsl1 T A 1: 75,482,096 (GRCm39) N258I probably damaging Het
Or1j4 A G 2: 36,740,156 (GRCm39) T33A probably benign Het
Or2y1b G T 11: 49,208,968 (GRCm39) M198I probably benign Het
Or5p6 T C 7: 107,631,470 (GRCm39) R27G possibly damaging Het
Or5p73 T C 7: 108,064,693 (GRCm39) V54A probably benign Het
Pax2 G A 19: 44,749,328 (GRCm39) V20M probably damaging Het
Pigb A T 9: 72,922,546 (GRCm39) M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pik3c2a T C 7: 116,017,271 (GRCm39) Y162C probably damaging Het
Pik3c2g A T 6: 139,599,067 (GRCm39) D61V probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Pramel17 A G 4: 101,694,448 (GRCm39) V145A probably damaging Het
Prss46 A G 9: 110,685,144 (GRCm39) D256G probably benign Het
Rims1 G T 1: 22,482,437 (GRCm39) D196E Het
Sbf1 A G 15: 89,178,408 (GRCm39) L1498P probably damaging Het
Sh2b1 T C 7: 126,068,479 (GRCm39) D444G possibly damaging Het
Slc7a15 T G 12: 8,589,395 (GRCm39) M51L probably damaging Het
Slitrk1 T C 14: 109,150,697 (GRCm39) I5V probably benign Het
Spart T A 3: 55,024,773 (GRCm39) C123S probably benign Het
Sry C T Y: 2,663,303 (GRCm39) R119K possibly damaging Het
Tasor2 C T 13: 3,625,681 (GRCm39) S1423N probably benign Het
Tbcc T C 17: 47,201,686 (GRCm39) V24A possibly damaging Het
Tfap2a T A 13: 40,872,684 (GRCm39) M331L possibly damaging Het
Thnsl1 A G 2: 21,216,755 (GRCm39) I170V probably benign Het
Ticrr T G 7: 79,343,796 (GRCm39) S1220R probably damaging Het
Tmem262 T C 19: 6,130,507 (GRCm39) M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 (GRCm39) S771P probably damaging Het
Tsc2 G A 17: 24,818,570 (GRCm39) A1423V probably damaging Het
Ubr4 T A 4: 139,139,941 (GRCm39) Y1175N probably damaging Het
Usp25 G A 16: 76,873,956 (GRCm39) A511T probably benign Het
Vmn2r115 T A 17: 23,563,124 (GRCm39) Y58* probably null Het
Wt1 T C 2: 104,957,789 (GRCm39) probably null Het
Zfp735 A T 11: 73,603,140 (GRCm39) K695* probably null Het
Zkscan14 A G 5: 145,132,568 (GRCm39) F321S possibly damaging Het
Zswim9 T C 7: 12,995,064 (GRCm39) E364G probably damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,142,121 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,195,432 (GRCm39) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,144,572 (GRCm39) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,168,665 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTACCAGCGGAAACATC -3'
(R):5'- ATAAACCCTGAGAAATCCCACTTTG -3'

Sequencing Primer
(F):5'- AAAAAGGAAGCTCTGTCTCTGC -3'
(R):5'- GGTGTTTTCAACTGGACATGAACC -3'
Posted On 2020-01-23