Incidental Mutation 'R8005:Wt1'
ID616552
Institutional Source Beutler Lab
Gene Symbol Wt1
Ensembl Gene ENSMUSG00000016458
Gene NameWilms tumor 1 homolog
SynonymsWt-1, D630046I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location105126529-105173616 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 105127444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111098] [ENSMUST00000111099] [ENSMUST00000133470] [ENSMUST00000143043] [ENSMUST00000146842] [ENSMUST00000213301]
Predicted Effect probably benign
Transcript: ENSMUST00000111098
SMART Domains Protein: ENSMUSP00000106727
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 160 5e-93 PFAM
ZnF_C2H2 162 186 1.33e-1 SMART
ZnF_C2H2 192 216 2.12e-4 SMART
ZnF_C2H2 222 244 1.92e-2 SMART
ZnF_C2H2 253 277 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111099
SMART Domains Protein: ENSMUSP00000106728
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 119 6.2e-63 PFAM
Pfam:WT1 113 177 4.6e-27 PFAM
ZnF_C2H2 179 203 1.33e-1 SMART
ZnF_C2H2 209 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.92e-2 SMART
ZnF_C2H2 267 291 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133470
SMART Domains Protein: ENSMUSP00000120054
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 304 3.2e-165 PFAM
ZnF_C2H2 306 330 1.33e-1 SMART
ZnF_C2H2 336 360 2.12e-4 SMART
ZnF_C2H2 366 388 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139585
SMART Domains Protein: ENSMUSP00000123592
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 235 9.8e-135 PFAM
ZnF_C2H2 237 261 1.33e-1 SMART
ZnF_C2H2 267 291 2.12e-4 SMART
ZnF_C2H2 297 319 1.92e-2 SMART
ZnF_C2H2 325 349 1.89e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143043
SMART Domains Protein: ENSMUSP00000117891
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 69 389 1e-149 PFAM
ZnF_C2H2 391 415 1.33e-1 SMART
ZnF_C2H2 421 445 2.12e-4 SMART
ZnF_C2H2 451 473 1.92e-2 SMART
ZnF_C2H2 482 506 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146842
SMART Domains Protein: ENSMUSP00000120702
Gene: ENSMUSG00000016458

DomainStartEndE-ValueType
Pfam:WT1 1 225 5.1e-117 PFAM
Pfam:WT1 222 278 2.1e-26 PFAM
ZnF_C2H2 280 304 1.33e-1 SMART
ZnF_C2H2 310 334 2.12e-4 SMART
ZnF_C2H2 340 362 1.92e-2 SMART
ZnF_C2H2 371 395 1.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213301
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutants fail to develop normal kidneys or gonads, and on some genetic backgrounds, a spleen. Mutants have abnormalities of the heart, mesothelium and lungs and die between embryonic day 13.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Apol7e C T 15: 77,718,077 Q292* probably null Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr10 G T 11: 49,318,141 M198I probably benign Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Pik3c2g A T 6: 139,622,069 D61V probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Spg20 T A 3: 55,117,352 C123S probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Vmn2r115 T A 17: 23,344,150 Y58* probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Wt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Wt1 APN 2 105144141 critical splice acceptor site probably null
IGL00846:Wt1 APN 2 105166957 missense probably damaging 1.00
IGL01411:Wt1 APN 2 105132974 missense probably damaging 1.00
IGL02936:Wt1 APN 2 105169039 missense probably damaging 1.00
IGL03063:Wt1 APN 2 105170023 splice site probably null
R0127:Wt1 UTSW 2 105133457 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R1462:Wt1 UTSW 2 105166831 missense probably damaging 1.00
R2061:Wt1 UTSW 2 105131157 splice site probably null
R2284:Wt1 UTSW 2 105172321 missense probably benign 0.43
R2358:Wt1 UTSW 2 105163428 splice site probably benign
R3711:Wt1 UTSW 2 105163428 splice site probably benign
R5096:Wt1 UTSW 2 105143125 missense probably damaging 1.00
R5590:Wt1 UTSW 2 105127284 missense probably damaging 1.00
R5984:Wt1 UTSW 2 105172252 missense probably benign 0.44
R6821:Wt1 UTSW 2 105172267 missense probably damaging 1.00
R7128:Wt1 UTSW 2 105127325 missense probably benign 0.04
R7698:Wt1 UTSW 2 105126816 missense probably benign 0.33
R7913:Wt1 UTSW 2 105166860 missense probably damaging 0.98
Z1176:Wt1 UTSW 2 105127107 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCAAACAGGAGCCCAGCTG -3'
(R):5'- TGTCACTCGCATTTGACAGAGC -3'

Sequencing Primer
(F):5'- ACACGAGGAGCAGTGCCTG -3'
(R):5'- GCATTTGACAGAGCCCACTC -3'
Posted On2020-01-23