Incidental Mutation 'R8005:Spg20'
ID616555
Institutional Source Beutler Lab
Gene Symbol Spg20
Ensembl Gene ENSMUSG00000036580
Gene Namespastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
SynonymsTAHCCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location55112108-55137322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55117352 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 123 (C123S)
Ref Sequence ENSEMBL: ENSMUSP00000042367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
Predicted Effect probably benign
Transcript: ENSMUST00000044116
AA Change: C123S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: C123S

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107971
AA Change: C123S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: C123S

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117341
AA Change: C123S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: C123S

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118118
AA Change: C123S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: C123S

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146109
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149767
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Apol7e C T 15: 77,718,077 Q292* probably null Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr10 G T 11: 49,318,141 M198I probably benign Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Pik3c2g A T 6: 139,622,069 D61V probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Vmn2r115 T A 17: 23,344,150 Y58* probably null Het
Wt1 T C 2: 105,127,444 probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Spg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spg20 APN 3 55121756 missense probably damaging 1.00
IGL01539:Spg20 APN 3 55117302 missense possibly damaging 0.95
IGL01982:Spg20 APN 3 55128490 splice site probably null
IGL02345:Spg20 APN 3 55117726 splice site probably null
IGL03217:Spg20 APN 3 55128491 splice site probably benign
IGL03344:Spg20 APN 3 55121685 missense probably benign 0.03
BB007:Spg20 UTSW 3 55128276 missense probably damaging 1.00
BB017:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R0145:Spg20 UTSW 3 55127671 nonsense probably null
R0522:Spg20 UTSW 3 55128365 missense probably damaging 1.00
R1506:Spg20 UTSW 3 55117571 missense probably damaging 0.99
R2043:Spg20 UTSW 3 55127548 missense probably damaging 1.00
R2183:Spg20 UTSW 3 55117133 missense probably benign 0.43
R4022:Spg20 UTSW 3 55117736 missense probably damaging 1.00
R5154:Spg20 UTSW 3 55117329 missense probably damaging 1.00
R5869:Spg20 UTSW 3 55135510 missense probably benign 0.00
R5987:Spg20 UTSW 3 55126541 missense probably benign 0.00
R6142:Spg20 UTSW 3 55117248 missense probably damaging 1.00
R6185:Spg20 UTSW 3 55117219 missense probably damaging 1.00
R6652:Spg20 UTSW 3 55124827 missense probably benign 0.00
R6791:Spg20 UTSW 3 55127561 missense probably damaging 1.00
R7131:Spg20 UTSW 3 55121799 critical splice donor site probably null
R7930:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R8458:Spg20 UTSW 3 55124894 missense probably damaging 1.00
RF009:Spg20 UTSW 3 55127606 missense probably benign 0.00
X0018:Spg20 UTSW 3 55135499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGGGGCATCAGCATC -3'
(R):5'- CATAGGAAACAGTGTAGTGGCCC -3'

Sequencing Primer
(F):5'- GCATCGCGGCTGCAGAG -3'
(R):5'- AAACAGTGTAGTGGCCCTCAGC -3'
Posted On2020-01-23