Incidental Mutation 'R8005:Pik3c2g'
ID616563
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139622069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 61 (D61V)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect probably benign
Transcript: ENSMUST00000032353
AA Change: D61V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: D61V

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000185968
AA Change: D61V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: D61V

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187618
AA Change: D61V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: D61V

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188066
AA Change: D61V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000190962
AA Change: D61V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: D61V

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Apol7e C T 15: 77,718,077 Q292* probably null Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr10 G T 11: 49,318,141 M198I probably benign Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Spg20 T A 3: 55,117,352 C123S probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Vmn2r115 T A 17: 23,344,150 Y58* probably null Het
Wt1 T C 2: 105,127,444 probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACAGTTGGCAAACAGAGC -3'
(R):5'- TGCCATGATATTTTCCACTGGG -3'

Sequencing Primer
(F):5'- GAGCCAAATCGCACTGAAC -3'
(R):5'- TCCACTGGGATTTCTCCAGGAAG -3'
Posted On2020-01-23