Incidental Mutation 'R0676:Gm10845'
ID61658
Institutional Source Beutler Lab
Gene Symbol Gm10845
Ensembl Gene ENSMUSG00000095959
Gene Namepredicted gene 10845
Synonyms
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0676 (G1)
Quality Score123
Status Validated
Chromosome14
Chromosomal Location79863074-79868398 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 79863204 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000179430]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179430
SMART Domains Protein: ENSMUSP00000137634
Gene: ENSMUSG00000095959

DomainStartEndE-ValueType
low complexity region 31 36 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228217
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Gm10845
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0106:Gm10845 UTSW 14 79863204 exon noncoding transcript
R0106:Gm10845 UTSW 14 79863204 exon noncoding transcript
R1620:Gm10845 UTSW 14 79863229 exon noncoding transcript
R3433:Gm10845 UTSW 14 79863411 exon noncoding transcript
R4374:Gm10845 UTSW 14 79863123 exon noncoding transcript
R5727:Gm10845 UTSW 14 79863330 exon noncoding transcript
R5975:Gm10845 UTSW 14 79863174 exon noncoding transcript
Predicted Primers
Posted On2013-07-30