Incidental Mutation 'R8005:Olfr10'
ID616582
Institutional Source Beutler Lab
Gene Symbol Olfr10
Ensembl Gene ENSMUSG00000100923
Gene Nameolfactory receptor 10
SynonymsMOR256-55, L45, GA_x6K02T2QP88-6117098-6116163
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49304741-49320021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49318141 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 198 (M198I)
Ref Sequence ENSEMBL: ENSMUSP00000149724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187570] [ENSMUST00000215671] [ENSMUST00000217290]
Predicted Effect probably benign
Transcript: ENSMUST00000187570
AA Change: M198I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: M198I

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215671
Predicted Effect probably benign
Transcript: ENSMUST00000217290
AA Change: M198I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Apol7e C T 15: 77,718,077 Q292* probably null Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Pik3c2g A T 6: 139,622,069 D61V probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Spg20 T A 3: 55,117,352 C123S probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Vmn2r115 T A 17: 23,344,150 Y58* probably null Het
Wt1 T C 2: 105,127,444 probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Olfr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Olfr10 APN 11 49318300 nonsense probably null 0.00
IGL02283:Olfr10 APN 11 49318335 missense probably benign
IGL03010:Olfr10 APN 11 49318146 missense probably damaging 0.99
R0575:Olfr10 UTSW 11 49318053 missense probably damaging 1.00
R1430:Olfr10 UTSW 11 49318101 unclassified probably null
R1891:Olfr10 UTSW 11 49317857 missense probably benign 0.00
R2509:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R2511:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R4942:Olfr10 UTSW 11 49317548 start codon destroyed probably null 0.99
R5080:Olfr10 UTSW 11 49318087 missense probably benign 0.03
R5413:Olfr10 UTSW 11 49318413 missense probably damaging 1.00
R5843:Olfr10 UTSW 11 49318249 missense probably benign 0.34
R6354:Olfr10 UTSW 11 49317638 missense probably damaging 0.98
R6605:Olfr10 UTSW 11 49317714 missense probably damaging 0.97
R8284:Olfr10 UTSW 11 49318175 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTCTCTGCCAGGCATTG -3'
(R):5'- AACTTCCCCTTGCTCTCAGAATAG -3'

Sequencing Primer
(F):5'- AGGCATTGGCTATTGCTTCC -3'
(R):5'- GCTCTCAGAATAGCTGTCTTTGG -3'
Posted On2020-01-23