Incidental Mutation 'R8005:Apol7e'
ID616595
Institutional Source Beutler Lab
Gene Symbol Apol7e
Ensembl Gene ENSMUSG00000071716
Gene Nameapolipoprotein L 7e
SynonymsENSMUSG00000071716
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77698857-77719285 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 77718077 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 292 (Q292*)
Ref Sequence ENSEMBL: ENSMUSP00000094085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096358]
Predicted Effect probably null
Transcript: ENSMUST00000096358
AA Change: Q292*
SMART Domains Protein: ENSMUSP00000094085
Gene: ENSMUSG00000071716
AA Change: Q292*

DomainStartEndE-ValueType
Pfam:ApoL 20 82 2.3e-14 PFAM
Pfam:ApoL 77 367 6.9e-121 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr10 G T 11: 49,318,141 M198I probably benign Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Pik3c2g A T 6: 139,622,069 D61V probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Spg20 T A 3: 55,117,352 C123S probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Vmn2r115 T A 17: 23,344,150 Y58* probably null Het
Wt1 T C 2: 105,127,444 probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Apol7e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Apol7e APN 15 77714348 critical splice acceptor site probably null
R0864:Apol7e UTSW 15 77717793 missense probably damaging 1.00
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1585:Apol7e UTSW 15 77717829 missense probably damaging 0.99
R1897:Apol7e UTSW 15 77717894 missense probably benign
R2047:Apol7e UTSW 15 77717610 missense probably benign 0.06
R2311:Apol7e UTSW 15 77718036 missense probably benign 0.14
R2895:Apol7e UTSW 15 77714467 missense possibly damaging 0.65
R3809:Apol7e UTSW 15 77718062 missense probably benign 0.05
R3842:Apol7e UTSW 15 77717589 missense probably damaging 1.00
R5351:Apol7e UTSW 15 77718311 makesense probably null
R5629:Apol7e UTSW 15 77718076 missense probably benign 0.08
R5853:Apol7e UTSW 15 77714467 missense probably benign
R5882:Apol7e UTSW 15 77718247 missense probably benign
R6337:Apol7e UTSW 15 77714382 missense possibly damaging 0.80
R6826:Apol7e UTSW 15 77718291 missense probably damaging 0.99
R7422:Apol7e UTSW 15 77714352 nonsense probably null
R7458:Apol7e UTSW 15 77714404 missense probably benign 0.20
R7470:Apol7e UTSW 15 77717943 missense probably benign
R7492:Apol7e UTSW 15 77717456 missense possibly damaging 0.95
R8119:Apol7e UTSW 15 77717756 missense probably damaging 1.00
R8190:Apol7e UTSW 15 77717807 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAGTTTTGGATCAGAGTGGTCC -3'
(R):5'- CTGTCATGGACCCGAATGAG -3'

Sequencing Primer
(F):5'- ATCAGAGTGGTCCCAGACTTC -3'
(R):5'- CGAATGAGCTCCTGTAACTTCTG -3'
Posted On2020-01-23