Incidental Mutation 'R8005:Vmn2r115'
ID616599
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8005 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 23344150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 58 (Y58*)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably null
Transcript: ENSMUST00000168175
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: Y58*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,017,000 D294G probably benign Het
Ak8 A T 2: 28,712,302 S83C probably benign Het
Ankrd34b C A 13: 92,438,722 A154E possibly damaging Het
Anks1 A G 17: 28,059,367 D1175G probably damaging Het
Ano4 T A 10: 88,971,321 L799F probably benign Het
Aplp1 T C 7: 30,436,045 probably null Het
Apob A T 12: 8,009,744 H2742L probably benign Het
Apol7e C T 15: 77,718,077 Q292* probably null Het
Atp2b1 G A 10: 98,994,799 G374D probably damaging Het
B020004J07Rik A G 4: 101,837,251 V145A probably damaging Het
B4galt5 A G 2: 167,301,464 S347P probably damaging Het
Bcl11b T C 12: 107,916,197 T620A probably benign Het
Bco2 T A 9: 50,538,913 D329V probably damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Copg2 T A 6: 30,896,697 M1L possibly damaging Het
D430041D05Rik G A 2: 104,258,254 H164Y possibly damaging Het
Dscaml1 G T 9: 45,717,510 G1121C probably damaging Het
Fam208b C T 13: 3,575,681 S1423N probably benign Het
Gas2l1 A T 11: 5,061,552 S426T probably benign Het
Gm17783 T C 16: 45,532,037 probably benign Het
Gm9195 T A 14: 72,426,400 I2740F probably benign Het
Irgm1 A G 11: 48,866,390 I214T probably damaging Het
Kbtbd3 C T 9: 4,330,655 T343I probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Ly75 A T 2: 60,332,934 Y804N probably damaging Het
Mgat2 A G 12: 69,185,948 H432R probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Nup54 T C 5: 92,428,147 I162V probably benign Het
Obsl1 T A 1: 75,505,452 N258I probably damaging Het
Olfr10 G T 11: 49,318,141 M198I probably benign Het
Olfr350 A G 2: 36,850,144 T33A probably benign Het
Olfr478 T C 7: 108,032,263 R27G possibly damaging Het
Olfr498 T C 7: 108,465,486 V54A probably benign Het
Pax2 G A 19: 44,760,889 V20M probably damaging Het
Pigb A T 9: 73,015,264 M13K unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pik3c2a T C 7: 116,418,036 Y162C probably damaging Het
Pik3c2g A T 6: 139,622,069 D61V probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prss46 A G 9: 110,856,076 D256G probably benign Het
Rims1 G T 1: 22,412,213 D196E Het
Sbf1 A G 15: 89,294,205 L1498P probably damaging Het
Sh2b1 T C 7: 126,469,307 D444G possibly damaging Het
Slc7a15 T G 12: 8,539,395 M51L probably damaging Het
Slitrk1 T C 14: 108,913,265 I5V probably benign Het
Spg20 T A 3: 55,117,352 C123S probably benign Het
Sry C T Y: 2,663,303 R119K possibly damaging Het
Tbcc T C 17: 46,890,760 V24A possibly damaging Het
Tfap2a T A 13: 40,719,208 M331L possibly damaging Het
Thnsl1 A G 2: 21,211,944 I170V probably benign Het
Ticrr T G 7: 79,694,048 S1220R probably damaging Het
Tmem262 T C 19: 6,080,477 M77T possibly damaging Het
Tmem67 A G 4: 12,047,821 S771P probably damaging Het
Tsc2 G A 17: 24,599,596 A1423V probably damaging Het
Ubr4 T A 4: 139,412,630 Y1175N probably damaging Het
Usp25 G A 16: 77,077,068 A511T probably benign Het
Wt1 T C 2: 105,127,444 probably null Het
Zfp735 A T 11: 73,712,314 K695* probably null Het
Zkscan14 A G 5: 145,195,758 F321S possibly damaging Het
Zswim9 T C 7: 13,261,138 E364G probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
R7353:Vmn2r115 UTSW 17 23345913 missense possibly damaging 0.65
R7483:Vmn2r115 UTSW 17 23346397 missense possibly damaging 0.95
R7743:Vmn2r115 UTSW 17 23345798 nonsense probably null
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TACTGCCCAGACTCAGAACAGG -3'
(R):5'- TCCATTCCTATGTGCGAGGC -3'

Sequencing Primer
(F):5'- CCAGACTCAGAACAGGAAAAATATG -3'
(R):5'- GCAGGCTGAAAACACCAT -3'
Posted On2020-01-23