Mutagenetix > Incidental Mutation

Incidental Mutation 'R8006:Ppip5k2'

616608

Institutional Source

Beutler Lab

Gene Symbol

Ppip5k2

Ensembl Gene

ENSMUSG00000040648

Gene Name

diphosphoinositol pentakisphosphate kinase 2

Synonyms

Hisppd1, Vip2

MMRRC Submission

046046-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R8006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97706048-97770411 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97734106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 695 (I695T)

Ref Sequence

ENSEMBL: ENSMUSP00000043401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]

AlphaFold

Q6ZQB6

Predicted Effect

probably benign
Transcript: ENSMUST00000042509
AA Change: I695T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: I695T

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112845
AA Change: I689T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: I689T

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	6.9e-141	PFAM
low complexity region	993	1006	N/A	INTRINSIC
low complexity region	1192	1211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171129
AA Change: I689T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: I689T

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	T	A	8: 40,795,907	H351Q	probably benign	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Akap13	T	C	7: 75,579,696	S126P	probably damaging	Het
Akip1	A	G	7: 109,703,992	D14G	probably damaging	Het
Ankhd1	A	G	18: 36,648,719	R287G		Het
Ankrd13a	A	C	5: 114,804,423	*589S	probably null	Het
Ankrd34c	T	C	9: 89,729,836	I151V	probably damaging	Het
Ano5	T	A	7: 51,593,770	D880E	probably benign	Het
Arl3	A	C	19: 46,558,374	L4R	probably damaging	Het
Ate1	T	A	7: 130,467,388	Q340L	probably damaging	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr3	C	T	9: 108,829,107	P930S	probably damaging	Het
Cox18	C	T	5: 90,223,813	V43M	probably damaging	Het
Ctnna3	A	G	10: 63,582,011	K176R	probably benign	Het
Fam135b	T	C	15: 71,462,334	T1004A	probably benign	Het
Fam227a	A	G	15: 79,634,098	I335T	possibly damaging	Het
Gm14496	A	G	2: 181,995,876	I248V	probably benign	Het
Gm4788	A	G	1: 139,736,852	Y490H	probably damaging	Het
Gm5415	T	A	1: 32,546,924		probably benign	Het
Gm6871	T	C	7: 41,545,682	T544A	probably benign	Het
Grm6	A	T	11: 50,864,657	*872L	probably null	Het
Herc1	T	A	9: 66,445,560	Y2109*	probably null	Het
Hsd11b2	T	A	8: 105,519,103	V80E	possibly damaging	Het
Itgb3	T	C	11: 104,665,496	V721A	possibly damaging	Het
Jade1	A	T	3: 41,613,689	I731L	probably benign	Het
Khnyn	G	A	14: 55,887,590	V434I	probably benign	Het
Lrp1	A	G	10: 127,589,619	L714P	probably damaging	Het
Lrrc41	G	A	4: 116,094,888	E585K	possibly damaging	Het
Lrrfip1	A	G	1: 91,076,951	Y70C	probably damaging	Het
Mex3a	T	A	3: 88,537,086	C490S	probably damaging	Het
Mmp27	C	T	9: 7,578,984	R387C	probably damaging	Het
Mro	A	T	18: 73,877,506	D219V	possibly damaging	Het
Myot	T	A	18: 44,354,837	L407Q	probably damaging	Het
Nppa	T	A	4: 148,001,181	W82R	probably damaging	Het
Olfr243	T	A	7: 103,717,325	C244S	probably damaging	Het
Olfr981	T	G	9: 40,022,474	L27R	probably damaging	Het
Olfr994	T	C	2: 85,429,974	N285S	probably damaging	Het
Phip	T	A	9: 82,890,126	I1123L	possibly damaging	Het
Ppp1r10	A	T	17: 35,928,266	M347L	probably benign	Het
Reln	A	T	5: 21,899,084	C3296*	probably null	Het
Slf2	T	A	19: 44,942,317	L611Q	probably damaging	Het
Spire1	G	A	18: 67,501,181	Q396*	probably null	Het
Taf2	A	G	15: 55,048,701	F537L	probably damaging	Het
Tbc1d16	C	T	11: 119,156,072	E451K	probably damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tmem267	T	A	13: 119,609,238	V143E	probably damaging	Het
Tyw1	C	T	5: 130,268,072	R177W	possibly damaging	Het
Vcp	A	T	4: 42,985,993	H340Q	probably benign	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Wnk4	A	G	11: 101,268,356	D533G	probably benign	Het
Wwp1	A	T	4: 19,650,174	C331S	probably benign	Het
Zik1	A	T	7: 10,490,173	C332*	probably null	Het

Other mutations in Ppip5k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01927:Ppip5k2	APN	1	97713123	missense	probably damaging	1.00
IGL02266:Ppip5k2	APN	1	97733972	missense	possibly damaging	0.68
IGL02705:Ppip5k2	APN	1	97759199	missense	probably damaging	1.00
IGL03229:Ppip5k2	APN	1	97728961	missense	probably damaging	1.00
P0033:Ppip5k2	UTSW	1	97717528	missense	probably damaging	0.98
R0082:Ppip5k2	UTSW	1	97759332	nonsense	probably null
R0242:Ppip5k2	UTSW	1	97741091	missense	probably damaging	1.00
R0242:Ppip5k2	UTSW	1	97741091	missense	probably damaging	1.00
R0267:Ppip5k2	UTSW	1	97728997	missense	probably damaging	1.00
R0281:Ppip5k2	UTSW	1	97716553	missense	possibly damaging	0.95
R0373:Ppip5k2	UTSW	1	97740537	nonsense	probably null
R0402:Ppip5k2	UTSW	1	97719854	missense	probably benign	0.00
R0423:Ppip5k2	UTSW	1	97761427	missense	possibly damaging	0.95
R0613:Ppip5k2	UTSW	1	97752740	nonsense	probably null
R0751:Ppip5k2	UTSW	1	97749652	nonsense	probably null
R1121:Ppip5k2	UTSW	1	97756860	missense	probably damaging	1.00
R1265:Ppip5k2	UTSW	1	97719900	missense	probably benign	0.00
R1436:Ppip5k2	UTSW	1	97711782	missense	probably benign	0.04
R1543:Ppip5k2	UTSW	1	97740882	missense	probably damaging	1.00
R1739:Ppip5k2	UTSW	1	97728957	missense	probably damaging	1.00
R1845:Ppip5k2	UTSW	1	97723806	missense	possibly damaging	0.74
R2191:Ppip5k2	UTSW	1	97744110	missense	probably damaging	0.99
R2430:Ppip5k2	UTSW	1	97735030	missense	probably damaging	1.00
R2762:Ppip5k2	UTSW	1	97717509	missense	probably damaging	1.00
R3014:Ppip5k2	UTSW	1	97744075	missense	probably damaging	0.99
R3759:Ppip5k2	UTSW	1	97755885	critical splice donor site	probably null
R4603:Ppip5k2	UTSW	1	97755136	missense	probably damaging	1.00
R4772:Ppip5k2	UTSW	1	97721067	unclassified	probably benign
R4951:Ppip5k2	UTSW	1	97711749	missense	possibly damaging	0.77
R5348:Ppip5k2	UTSW	1	97747592	missense	possibly damaging	0.94
R5350:Ppip5k2	UTSW	1	97721128	missense	probably damaging	0.98
R5584:Ppip5k2	UTSW	1	97750641	missense	probably damaging	1.00
R5599:Ppip5k2	UTSW	1	97740598	missense	probably damaging	1.00
R5883:Ppip5k2	UTSW	1	97707810	missense	possibly damaging	0.53
R5898:Ppip5k2	UTSW	1	97744162	intron	probably benign
R6184:Ppip5k2	UTSW	1	97734005	missense	possibly damaging	0.89
R6221:Ppip5k2	UTSW	1	97730028	missense	probably damaging	1.00
R6775:Ppip5k2	UTSW	1	97719860	missense	possibly damaging	0.49
R7250:Ppip5k2	UTSW	1	97745462	missense	probably benign	0.00
R7329:Ppip5k2	UTSW	1	97750753	splice site	probably null
R7357:Ppip5k2	UTSW	1	97759216	missense	possibly damaging	0.91
R7852:Ppip5k2	UTSW	1	97741171	missense	probably damaging	0.99
R7884:Ppip5k2	UTSW	1	97740482	missense	probably benign	0.00
R8134:Ppip5k2	UTSW	1	97745163	missense	probably benign	0.12
R8274:Ppip5k2	UTSW	1	97759216	missense	possibly damaging	0.91
R8436:Ppip5k2	UTSW	1	97755888	missense	probably benign
R8440:Ppip5k2	UTSW	1	97747551	missense	probably damaging	0.99
R8895:Ppip5k2	UTSW	1	97711819	missense	probably benign
R9017:Ppip5k2	UTSW	1	97727414	missense	probably damaging	1.00
R9061:Ppip5k2	UTSW	1	97717462	missense	probably damaging	1.00
R9441:Ppip5k2	UTSW	1	97745196	missense	probably benign	0.00
R9533:Ppip5k2	UTSW	1	97734067	missense	probably benign	0.11
R9715:Ppip5k2	UTSW	1	97749587	missense
R9792:Ppip5k2	UTSW	1	97744097	nonsense	probably null
R9793:Ppip5k2	UTSW	1	97744097	nonsense	probably null
R9795:Ppip5k2	UTSW	1	97744097	nonsense	probably null
Z1177:Ppip5k2	UTSW	1	97716605	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTTTGAAAGCCTATATAGTTCC -3'
(R):5'- GTAGTACTTCCTAGCTTCTTAGGGC -3'

Sequencing Primer
(F):5'- TCCATTGTGTTTTCTAACTTCAAGG -3'
(R):5'- TTTTTACTCATAGGAAGCCAGTTATG -3'

Posted On

2020-01-23