Incidental Mutation 'R8006:Wwp1'
ID616614
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8006 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19650174 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 331 (C331S)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably benign
Transcript: ENSMUST00000035982
AA Change: C331S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: C331S

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108246
AA Change: C331S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: C331S

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 40,795,907 H351Q probably benign Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Akap13 T C 7: 75,579,696 S126P probably damaging Het
Akip1 A G 7: 109,703,992 D14G probably damaging Het
Ankhd1 A G 18: 36,648,719 R287G Het
Ankrd13a A C 5: 114,804,423 *589S probably null Het
Ankrd34c T C 9: 89,729,836 I151V probably damaging Het
Ano5 T A 7: 51,593,770 D880E probably benign Het
Arl3 A C 19: 46,558,374 L4R probably damaging Het
Ate1 T A 7: 130,467,388 Q340L probably damaging Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr3 C T 9: 108,829,107 P930S probably damaging Het
Cox18 C T 5: 90,223,813 V43M probably damaging Het
Ctnna3 A G 10: 63,582,011 K176R probably benign Het
Fam135b T C 15: 71,462,334 T1004A probably benign Het
Fam227a A G 15: 79,634,098 I335T possibly damaging Het
Gm14496 A G 2: 181,995,876 I248V probably benign Het
Gm4788 A G 1: 139,736,852 Y490H probably damaging Het
Gm5415 T A 1: 32,546,924 probably benign Het
Gm6871 T C 7: 41,545,682 T544A probably benign Het
Grm6 A T 11: 50,864,657 *872L probably null Het
Herc1 T A 9: 66,445,560 Y2109* probably null Het
Hsd11b2 T A 8: 105,519,103 V80E possibly damaging Het
Itgb3 T C 11: 104,665,496 V721A possibly damaging Het
Jade1 A T 3: 41,613,689 I731L probably benign Het
Khnyn G A 14: 55,887,590 V434I probably benign Het
Lrp1 A G 10: 127,589,619 L714P probably damaging Het
Lrrc41 G A 4: 116,094,888 E585K possibly damaging Het
Lrrfip1 A G 1: 91,076,951 Y70C probably damaging Het
Mex3a T A 3: 88,537,086 C490S probably damaging Het
Mmp27 C T 9: 7,578,984 R387C probably damaging Het
Mro A T 18: 73,877,506 D219V possibly damaging Het
Myot T A 18: 44,354,837 L407Q probably damaging Het
Nppa T A 4: 148,001,181 W82R probably damaging Het
Olfr243 T A 7: 103,717,325 C244S probably damaging Het
Olfr981 T G 9: 40,022,474 L27R probably damaging Het
Olfr994 T C 2: 85,429,974 N285S probably damaging Het
Phip T A 9: 82,890,126 I1123L possibly damaging Het
Ppip5k2 A G 1: 97,734,106 I695T probably benign Het
Ppp1r10 A T 17: 35,928,266 M347L probably benign Het
Reln A T 5: 21,899,084 C3296* probably null Het
Slf2 T A 19: 44,942,317 L611Q probably damaging Het
Spire1 G A 18: 67,501,181 Q396* probably null Het
Taf2 A G 15: 55,048,701 F537L probably damaging Het
Tbc1d16 C T 11: 119,156,072 E451K probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem267 T A 13: 119,609,238 V143E probably damaging Het
Tyw1 C T 5: 130,268,072 R177W possibly damaging Het
Vcp A T 4: 42,985,993 H340Q probably benign Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wnk4 A G 11: 101,268,356 D533G probably benign Het
Zik1 A T 7: 10,490,173 C332* probably null Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
BB008:Wwp1 UTSW 4 19650114 critical splice donor site probably null
BB018:Wwp1 UTSW 4 19650114 critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19650114 critical splice donor site probably null
R8851:Wwp1 UTSW 4 19643437 missense probably null 1.00
R8910:Wwp1 UTSW 4 19627741 missense possibly damaging 0.70
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACCGGATAAGTGACTGTTCTTAAC -3'
(R):5'- CTCGACTTCCAATTGCACTAGC -3'

Sequencing Primer
(F):5'- CAGGAATGAAATTTGAGCCCTCTGC -3'
(R):5'- TAGCACCACCACCCAAGAG -3'
Posted On2020-01-23