Incidental Mutation 'R0676:Taf6l'
ID61662
Institutional Source Beutler Lab
Gene Symbol Taf6l
Ensembl Gene ENSMUSG00000003680
Gene NameTATA-box binding protein associated factor 6 like
SynonymsPAF65A, 2810417N14Rik, C530024J06Rik
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0676 (G1)
Quality Score108
Status Validated
Chromosome19
Chromosomal Location8772522-8786417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8773369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000010249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010241] [ENSMUST00000010248] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000184970] [ENSMUST00000189739]
Predicted Effect probably benign
Transcript: ENSMUST00000003777
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010248
SMART Domains Protein: ENSMUSP00000010248
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:TMEM223 32 197 6.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010249
AA Change: I114V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680
AA Change: I114V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176080
Predicted Effect probably benign
Transcript: ENSMUST00000176496
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176610
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176747
Predicted Effect probably benign
Transcript: ENSMUST00000177056
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177216
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184808
Predicted Effect probably benign
Transcript: ENSMUST00000184826
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185056
Predicted Effect probably benign
Transcript: ENSMUST00000189739
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Taf6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Taf6l APN 19 8783388 missense probably benign 0.04
IGL00781:Taf6l APN 19 8773661 missense probably damaging 1.00
IGL01886:Taf6l APN 19 8778086 critical splice donor site probably null
IGL02638:Taf6l APN 19 8775266 missense probably benign 0.03
IGL02676:Taf6l APN 19 8775049 missense probably damaging 1.00
R0096:Taf6l UTSW 19 8778517 missense probably benign 0.06
R0110:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0469:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0510:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0711:Taf6l UTSW 19 8778517 missense probably benign 0.06
R1804:Taf6l UTSW 19 8773634 missense probably damaging 0.99
R1971:Taf6l UTSW 19 8775502 unclassified probably null
R2869:Taf6l UTSW 19 8778628 unclassified probably benign
R2870:Taf6l UTSW 19 8778628 unclassified probably benign
R3105:Taf6l UTSW 19 8778855 missense probably damaging 1.00
R4578:Taf6l UTSW 19 8783971 missense possibly damaging 0.95
R4581:Taf6l UTSW 19 8778208 missense probably damaging 0.99
R4841:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R4842:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R5215:Taf6l UTSW 19 8778053 intron probably benign
R5269:Taf6l UTSW 19 8774962 missense probably damaging 1.00
R5571:Taf6l UTSW 19 8783930 missense probably damaging 1.00
R5687:Taf6l UTSW 19 8773312 missense probably benign 0.01
R5799:Taf6l UTSW 19 8782631 missense possibly damaging 0.93
R5814:Taf6l UTSW 19 8774846 missense probably benign 0.13
R6008:Taf6l UTSW 19 8778166 missense possibly damaging 0.65
R6091:Taf6l UTSW 19 8778556 missense probably benign 0.04
R6228:Taf6l UTSW 19 8778666 missense probably benign 0.01
R6569:Taf6l UTSW 19 8772710 missense probably damaging 1.00
R6768:Taf6l UTSW 19 8774549 missense probably damaging 1.00
R7586:Taf6l UTSW 19 8783846 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGCTCTAAGCACATCTGTGTCC -3'
(R):5'- GCTTCAGGCATCTTGGCACTCTAC -3'

Sequencing Primer
(F):5'- CACATCTGTGTCCTCAGAGATAAGG -3'
(R):5'- GGCACTCTACTGCCTTCTG -3'
Posted On2013-07-30