Incidental Mutation 'R8006:Vmn2r14'
ID 616620
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission 046046-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R8006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109368324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 223 (L223M)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: L223M

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: L223M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 41,248,944 (GRCm39) H351Q probably benign Het
Ahnak T C 19: 8,989,447 (GRCm39) V3577A possibly damaging Het
Akap13 T C 7: 75,229,444 (GRCm39) S126P probably damaging Het
Akip1 A G 7: 109,303,199 (GRCm39) D14G probably damaging Het
Ankhd1 A G 18: 36,781,772 (GRCm39) R287G Het
Ankrd13a A C 5: 114,942,484 (GRCm39) *589S probably null Het
Ankrd34c T C 9: 89,611,889 (GRCm39) I151V probably damaging Het
Ano5 T A 7: 51,243,518 (GRCm39) D880E probably benign Het
Arl3 A C 19: 46,546,813 (GRCm39) L4R probably damaging Het
Ate1 T A 7: 130,069,118 (GRCm39) Q340L probably damaging Het
Ccdc38 A T 10: 93,391,448 (GRCm39) probably null Het
Celsr3 C T 9: 108,706,306 (GRCm39) P930S probably damaging Het
Cfhr4 A G 1: 139,664,590 (GRCm39) Y490H probably damaging Het
Cox18 C T 5: 90,371,672 (GRCm39) V43M probably damaging Het
Ctnna3 A G 10: 63,417,790 (GRCm39) K176R probably benign Het
Fam135b T C 15: 71,334,183 (GRCm39) T1004A probably benign Het
Fam227a A G 15: 79,518,299 (GRCm39) I335T possibly damaging Het
Gm14496 A G 2: 181,637,669 (GRCm39) I248V probably benign Het
Gm6871 T C 7: 41,195,106 (GRCm39) T544A probably benign Het
Grm6 A T 11: 50,755,484 (GRCm39) *872L probably null Het
Herc1 T A 9: 66,352,842 (GRCm39) Y2109* probably null Het
Hsd11b2 T A 8: 106,245,735 (GRCm39) V80E possibly damaging Het
Itgb3 T C 11: 104,556,322 (GRCm39) V721A possibly damaging Het
Jade1 A T 3: 41,568,124 (GRCm39) I731L probably benign Het
Khnyn G A 14: 56,125,047 (GRCm39) V434I probably benign Het
Lrp1 A G 10: 127,425,488 (GRCm39) L714P probably damaging Het
Lrrc41 G A 4: 115,952,085 (GRCm39) E585K possibly damaging Het
Lrrfip1 A G 1: 91,004,673 (GRCm39) Y70C probably damaging Het
Mex3a T A 3: 88,444,393 (GRCm39) C490S probably damaging Het
Mmp27 C T 9: 7,578,985 (GRCm39) R387C probably damaging Het
Mro A T 18: 74,010,577 (GRCm39) D219V possibly damaging Het
Myot T A 18: 44,487,904 (GRCm39) L407Q probably damaging Het
Nppa T A 4: 148,085,638 (GRCm39) W82R probably damaging Het
Or10g6 T G 9: 39,933,770 (GRCm39) L27R probably damaging Het
Or52a20 T A 7: 103,366,532 (GRCm39) C244S probably damaging Het
Or5ak24 T C 2: 85,260,318 (GRCm39) N285S probably damaging Het
Phip T A 9: 82,772,179 (GRCm39) I1123L possibly damaging Het
Ppip5k2 A G 1: 97,661,831 (GRCm39) I695T probably benign Het
Ppp1r10 A T 17: 36,239,158 (GRCm39) M347L probably benign Het
Reln A T 5: 22,104,082 (GRCm39) C3296* probably null Het
Semp2l1 T A 1: 32,586,005 (GRCm39) probably benign Het
Slf2 T A 19: 44,930,756 (GRCm39) L611Q probably damaging Het
Spire1 G A 18: 67,634,251 (GRCm39) Q396* probably null Het
Taf2 A G 15: 54,912,097 (GRCm39) F537L probably damaging Het
Tbc1d16 C T 11: 119,046,898 (GRCm39) E451K probably damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tmem267 T A 13: 120,070,774 (GRCm39) V143E probably damaging Het
Tyw1 C T 5: 130,296,913 (GRCm39) R177W possibly damaging Het
Vcp A T 4: 42,985,993 (GRCm39) H340Q probably benign Het
Wnk4 A G 11: 101,159,182 (GRCm39) D533G probably benign Het
Wwp1 A T 4: 19,650,174 (GRCm39) C331S probably benign Het
Zik1 A T 7: 10,224,100 (GRCm39) C332* probably null Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109,369,222 (GRCm39) missense probably benign
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8007:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109,364,041 (GRCm39) missense probably damaging 1.00
R9774:Vmn2r14 UTSW 5 109,369,126 (GRCm39) missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCCATTGTGAGGTTGTGATCCAG -3'
(R):5'- GACCATTTAATCCTAAACTGAGTGACC -3'

Sequencing Primer
(F):5'- CACCTTCTAAAGCTGACTTCTAGGG -3'
(R):5'- ACTGAGTGACCATGACCAGTTTC -3'
Posted On 2020-01-23