Incidental Mutation 'R0676:Nolc1'
ID61663
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0676 (G1)
Quality Score109
Status Validated
Chromosome19
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 46080089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081370 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3806:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R5837:Nolc1 UTSW 19 46083183 unclassified probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
R8011:Nolc1 UTSW 19 46081584 missense unknown
R8806:Nolc1 UTSW 19 46083032 missense unknown
RF027:Nolc1 UTSW 19 46081363 small insertion probably benign
RF031:Nolc1 UTSW 19 46081371 small insertion probably benign
RF034:Nolc1 UTSW 19 46081371 small insertion probably benign
RF040:Nolc1 UTSW 19 46081363 small insertion probably benign
RF044:Nolc1 UTSW 19 46081371 small insertion probably benign
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTTTTAGCAGAAGGCAGCTAAGC -3'
(R):5'- AGACAGGGTCTGAGGAAACTTTCCAG -3'

Sequencing Primer
(F):5'- GGCAGCTAAGCCCCAAG -3'
(R):5'- aaatgcctttaatctcggcac -3'
Posted On2013-07-30