Incidental Mutation 'R8006:Hsd11b2'
ID616631
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Namehydroxysteroid 11-beta dehydrogenase 2
Synonyms11HSD2, 11(beta)-HSD2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8006 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105518755-105523988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105519103 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 80 (V80E)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034363
AA Change: V80E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: V80E

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 40,795,907 H351Q probably benign Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Akap13 T C 7: 75,579,696 S126P probably damaging Het
Akip1 A G 7: 109,703,992 D14G probably damaging Het
Ankhd1 A G 18: 36,648,719 R287G Het
Ankrd13a A C 5: 114,804,423 *589S probably null Het
Ankrd34c T C 9: 89,729,836 I151V probably damaging Het
Ano5 T A 7: 51,593,770 D880E probably benign Het
Arl3 A C 19: 46,558,374 L4R probably damaging Het
Ate1 T A 7: 130,467,388 Q340L probably damaging Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr3 C T 9: 108,829,107 P930S probably damaging Het
Cox18 C T 5: 90,223,813 V43M probably damaging Het
Ctnna3 A G 10: 63,582,011 K176R probably benign Het
Fam135b T C 15: 71,462,334 T1004A probably benign Het
Fam227a A G 15: 79,634,098 I335T possibly damaging Het
Gm14496 A G 2: 181,995,876 I248V probably benign Het
Gm4788 A G 1: 139,736,852 Y490H probably damaging Het
Gm5415 T A 1: 32,546,924 probably benign Het
Gm6871 T C 7: 41,545,682 T544A probably benign Het
Grm6 A T 11: 50,864,657 *872L probably null Het
Herc1 T A 9: 66,445,560 Y2109* probably null Het
Itgb3 T C 11: 104,665,496 V721A possibly damaging Het
Jade1 A T 3: 41,613,689 I731L probably benign Het
Khnyn G A 14: 55,887,590 V434I probably benign Het
Lrp1 A G 10: 127,589,619 L714P probably damaging Het
Lrrc41 G A 4: 116,094,888 E585K possibly damaging Het
Lrrfip1 A G 1: 91,076,951 Y70C probably damaging Het
Mex3a T A 3: 88,537,086 C490S probably damaging Het
Mmp27 C T 9: 7,578,984 R387C probably damaging Het
Mro A T 18: 73,877,506 D219V possibly damaging Het
Myot T A 18: 44,354,837 L407Q probably damaging Het
Nppa T A 4: 148,001,181 W82R probably damaging Het
Olfr243 T A 7: 103,717,325 C244S probably damaging Het
Olfr981 T G 9: 40,022,474 L27R probably damaging Het
Olfr994 T C 2: 85,429,974 N285S probably damaging Het
Phip T A 9: 82,890,126 I1123L possibly damaging Het
Ppip5k2 A G 1: 97,734,106 I695T probably benign Het
Ppp1r10 A T 17: 35,928,266 M347L probably benign Het
Reln A T 5: 21,899,084 C3296* probably null Het
Slf2 T A 19: 44,942,317 L611Q probably damaging Het
Spire1 G A 18: 67,501,181 Q396* probably null Het
Taf2 A G 15: 55,048,701 F537L probably damaging Het
Tbc1d16 C T 11: 119,156,072 E451K probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem267 T A 13: 119,609,238 V143E probably damaging Het
Tyw1 C T 5: 130,268,072 R177W possibly damaging Het
Vcp A T 4: 42,985,993 H340Q probably benign Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wnk4 A G 11: 101,268,356 D533G probably benign Het
Wwp1 A T 4: 19,650,174 C331S probably benign Het
Zik1 A T 7: 10,490,173 C332* probably null Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 105523151 missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 105523166 missense probably benign
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R5780:Hsd11b2 UTSW 8 105522155 missense probably damaging 1.00
R6058:Hsd11b2 UTSW 8 105523334 missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 105518874 missense probably damaging 0.99
R8110:Hsd11b2 UTSW 8 105522634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAAGCGAGTATCCCTCCC -3'
(R):5'- AACCCAGACTTGGTGAGGTG -3'

Sequencing Primer
(F):5'- AAGTCATGGAGCGCTGGC -3'
(R):5'- GCCCGGAGCTTCCTACTTG -3'
Posted On2020-01-23