Incidental Mutation 'R8006:Mmp27'
ID 616632
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7578984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 387 (R387C)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably damaging
Transcript: ENSMUST00000120900
AA Change: R387C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: R387C

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: R413C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: R413C

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
AA Change: R331C

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: R331C

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 40,795,907 H351Q probably benign Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Akap13 T C 7: 75,579,696 S126P probably damaging Het
Akip1 A G 7: 109,703,992 D14G probably damaging Het
Ankhd1 A G 18: 36,648,719 R287G Het
Ankrd13a A C 5: 114,804,423 *589S probably null Het
Ankrd34c T C 9: 89,729,836 I151V probably damaging Het
Ano5 T A 7: 51,593,770 D880E probably benign Het
Arl3 A C 19: 46,558,374 L4R probably damaging Het
Ate1 T A 7: 130,467,388 Q340L probably damaging Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr3 C T 9: 108,829,107 P930S probably damaging Het
Cox18 C T 5: 90,223,813 V43M probably damaging Het
Ctnna3 A G 10: 63,582,011 K176R probably benign Het
Fam135b T C 15: 71,462,334 T1004A probably benign Het
Fam227a A G 15: 79,634,098 I335T possibly damaging Het
Gm14496 A G 2: 181,995,876 I248V probably benign Het
Gm4788 A G 1: 139,736,852 Y490H probably damaging Het
Gm5415 T A 1: 32,546,924 probably benign Het
Gm6871 T C 7: 41,545,682 T544A probably benign Het
Grm6 A T 11: 50,864,657 *872L probably null Het
Herc1 T A 9: 66,445,560 Y2109* probably null Het
Hsd11b2 T A 8: 105,519,103 V80E possibly damaging Het
Itgb3 T C 11: 104,665,496 V721A possibly damaging Het
Jade1 A T 3: 41,613,689 I731L probably benign Het
Khnyn G A 14: 55,887,590 V434I probably benign Het
Lrp1 A G 10: 127,589,619 L714P probably damaging Het
Lrrc41 G A 4: 116,094,888 E585K possibly damaging Het
Lrrfip1 A G 1: 91,076,951 Y70C probably damaging Het
Mex3a T A 3: 88,537,086 C490S probably damaging Het
Mro A T 18: 73,877,506 D219V possibly damaging Het
Myot T A 18: 44,354,837 L407Q probably damaging Het
Nppa T A 4: 148,001,181 W82R probably damaging Het
Olfr243 T A 7: 103,717,325 C244S probably damaging Het
Olfr981 T G 9: 40,022,474 L27R probably damaging Het
Olfr994 T C 2: 85,429,974 N285S probably damaging Het
Phip T A 9: 82,890,126 I1123L possibly damaging Het
Ppip5k2 A G 1: 97,734,106 I695T probably benign Het
Ppp1r10 A T 17: 35,928,266 M347L probably benign Het
Reln A T 5: 21,899,084 C3296* probably null Het
Slf2 T A 19: 44,942,317 L611Q probably damaging Het
Spire1 G A 18: 67,501,181 Q396* probably null Het
Taf2 A G 15: 55,048,701 F537L probably damaging Het
Tbc1d16 C T 11: 119,156,072 E451K probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem267 T A 13: 119,609,238 V143E probably damaging Het
Tyw1 C T 5: 130,268,072 R177W possibly damaging Het
Vcp A T 4: 42,985,993 H340Q probably benign Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wnk4 A G 11: 101,268,356 D533G probably benign Het
Wwp1 A T 4: 19,650,174 C331S probably benign Het
Zik1 A T 7: 10,490,173 C332* probably null Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGAGGCATGAGATTACTGGGTTG -3'
(R):5'- GATTGCCGGCAACACAATC -3'

Sequencing Primer
(F):5'- CATGAGATTACTGGGTTGGCAGC -3'
(R):5'- CCACTGGGAGACTGTAGATTTG -3'
Posted On 2020-01-23