Incidental Mutation 'R8006:Mmp27'
ID 616632
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 046046-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571397-7581886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7578985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 387 (R387C)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably damaging
Transcript: ENSMUST00000120900
AA Change: R387C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: R387C

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: R413C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: R413C

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
AA Change: R331C

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: R331C

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 41,248,944 (GRCm39) H351Q probably benign Het
Ahnak T C 19: 8,989,447 (GRCm39) V3577A possibly damaging Het
Akap13 T C 7: 75,229,444 (GRCm39) S126P probably damaging Het
Akip1 A G 7: 109,303,199 (GRCm39) D14G probably damaging Het
Ankhd1 A G 18: 36,781,772 (GRCm39) R287G Het
Ankrd13a A C 5: 114,942,484 (GRCm39) *589S probably null Het
Ankrd34c T C 9: 89,611,889 (GRCm39) I151V probably damaging Het
Ano5 T A 7: 51,243,518 (GRCm39) D880E probably benign Het
Arl3 A C 19: 46,546,813 (GRCm39) L4R probably damaging Het
Ate1 T A 7: 130,069,118 (GRCm39) Q340L probably damaging Het
Ccdc38 A T 10: 93,391,448 (GRCm39) probably null Het
Celsr3 C T 9: 108,706,306 (GRCm39) P930S probably damaging Het
Cfhr4 A G 1: 139,664,590 (GRCm39) Y490H probably damaging Het
Cox18 C T 5: 90,371,672 (GRCm39) V43M probably damaging Het
Ctnna3 A G 10: 63,417,790 (GRCm39) K176R probably benign Het
Fam135b T C 15: 71,334,183 (GRCm39) T1004A probably benign Het
Fam227a A G 15: 79,518,299 (GRCm39) I335T possibly damaging Het
Gm14496 A G 2: 181,637,669 (GRCm39) I248V probably benign Het
Gm6871 T C 7: 41,195,106 (GRCm39) T544A probably benign Het
Grm6 A T 11: 50,755,484 (GRCm39) *872L probably null Het
Herc1 T A 9: 66,352,842 (GRCm39) Y2109* probably null Het
Hsd11b2 T A 8: 106,245,735 (GRCm39) V80E possibly damaging Het
Itgb3 T C 11: 104,556,322 (GRCm39) V721A possibly damaging Het
Jade1 A T 3: 41,568,124 (GRCm39) I731L probably benign Het
Khnyn G A 14: 56,125,047 (GRCm39) V434I probably benign Het
Lrp1 A G 10: 127,425,488 (GRCm39) L714P probably damaging Het
Lrrc41 G A 4: 115,952,085 (GRCm39) E585K possibly damaging Het
Lrrfip1 A G 1: 91,004,673 (GRCm39) Y70C probably damaging Het
Mex3a T A 3: 88,444,393 (GRCm39) C490S probably damaging Het
Mro A T 18: 74,010,577 (GRCm39) D219V possibly damaging Het
Myot T A 18: 44,487,904 (GRCm39) L407Q probably damaging Het
Nppa T A 4: 148,085,638 (GRCm39) W82R probably damaging Het
Or10g6 T G 9: 39,933,770 (GRCm39) L27R probably damaging Het
Or52a20 T A 7: 103,366,532 (GRCm39) C244S probably damaging Het
Or5ak24 T C 2: 85,260,318 (GRCm39) N285S probably damaging Het
Phip T A 9: 82,772,179 (GRCm39) I1123L possibly damaging Het
Ppip5k2 A G 1: 97,661,831 (GRCm39) I695T probably benign Het
Ppp1r10 A T 17: 36,239,158 (GRCm39) M347L probably benign Het
Reln A T 5: 22,104,082 (GRCm39) C3296* probably null Het
Semp2l1 T A 1: 32,586,005 (GRCm39) probably benign Het
Slf2 T A 19: 44,930,756 (GRCm39) L611Q probably damaging Het
Spire1 G A 18: 67,634,251 (GRCm39) Q396* probably null Het
Taf2 A G 15: 54,912,097 (GRCm39) F537L probably damaging Het
Tbc1d16 C T 11: 119,046,898 (GRCm39) E451K probably damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tmem267 T A 13: 120,070,774 (GRCm39) V143E probably damaging Het
Tyw1 C T 5: 130,296,913 (GRCm39) R177W possibly damaging Het
Vcp A T 4: 42,985,993 (GRCm39) H340Q probably benign Het
Vmn2r14 A T 5: 109,368,324 (GRCm39) L223M probably benign Het
Wnk4 A G 11: 101,159,182 (GRCm39) D533G probably benign Het
Wwp1 A T 4: 19,650,174 (GRCm39) C331S probably benign Het
Zik1 A T 7: 10,224,100 (GRCm39) C332* probably null Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7,573,505 (GRCm39) splice site probably benign
IGL00656:Mmp27 APN 9 7,581,383 (GRCm39) missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7,578,900 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7,573,416 (GRCm39) missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7,573,298 (GRCm39) missense probably benign 0.06
IGL01631:Mmp27 APN 9 7,573,289 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7,571,591 (GRCm39) missense probably benign 0.03
IGL03024:Mmp27 APN 9 7,581,377 (GRCm39) missense probably benign 0.17
R0662:Mmp27 UTSW 9 7,577,651 (GRCm39) missense probably benign 0.00
R0715:Mmp27 UTSW 9 7,581,156 (GRCm39) splice site probably benign
R0826:Mmp27 UTSW 9 7,579,010 (GRCm39) missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7,579,067 (GRCm39) splice site probably null
R1793:Mmp27 UTSW 9 7,571,459 (GRCm39) start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7,578,898 (GRCm39) splice site probably null
R2074:Mmp27 UTSW 9 7,577,740 (GRCm39) missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7,577,379 (GRCm39) nonsense probably null
R2445:Mmp27 UTSW 9 7,581,182 (GRCm39) missense probably benign 0.12
R2961:Mmp27 UTSW 9 7,573,603 (GRCm39) missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7,581,195 (GRCm39) missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R4938:Mmp27 UTSW 9 7,578,983 (GRCm39) missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7,579,001 (GRCm39) missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7,572,159 (GRCm39) missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R5446:Mmp27 UTSW 9 7,573,516 (GRCm39) splice site probably benign
R5485:Mmp27 UTSW 9 7,573,363 (GRCm39) missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7,579,063 (GRCm39) missense probably null 1.00
R6682:Mmp27 UTSW 9 7,573,606 (GRCm39) missense probably benign 0.02
R6712:Mmp27 UTSW 9 7,572,177 (GRCm39) missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7,571,955 (GRCm39) missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7,578,231 (GRCm39) missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7,577,318 (GRCm39) missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7,579,002 (GRCm39) missense probably damaging 1.00
R8185:Mmp27 UTSW 9 7,573,492 (GRCm39) missense unknown
R8537:Mmp27 UTSW 9 7,579,776 (GRCm39) missense probably benign 0.00
R9039:Mmp27 UTSW 9 7,581,250 (GRCm39) missense probably benign 0.01
R9087:Mmp27 UTSW 9 7,579,858 (GRCm39) missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7,579,792 (GRCm39) missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7,579,812 (GRCm39) missense probably benign 0.09
R9367:Mmp27 UTSW 9 7,573,550 (GRCm39) missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7,573,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGAGGCATGAGATTACTGGGTTG -3'
(R):5'- GATTGCCGGCAACACAATC -3'

Sequencing Primer
(F):5'- CATGAGATTACTGGGTTGGCAGC -3'
(R):5'- CCACTGGGAGACTGTAGATTTG -3'
Posted On 2020-01-23