Incidental Mutation 'R8006:Ctnna3'
ID616638
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R8006 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63582011 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 176 (K176R)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
AA Change: K176R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: K176R

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105440
AA Change: K176R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: K176R

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
AA Change: K176R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: K176R

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 40,795,907 H351Q probably benign Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Akap13 T C 7: 75,579,696 S126P probably damaging Het
Akip1 A G 7: 109,703,992 D14G probably damaging Het
Ankhd1 A G 18: 36,648,719 R287G Het
Ankrd13a A C 5: 114,804,423 *589S probably null Het
Ankrd34c T C 9: 89,729,836 I151V probably damaging Het
Ano5 T A 7: 51,593,770 D880E probably benign Het
Arl3 A C 19: 46,558,374 L4R probably damaging Het
Ate1 T A 7: 130,467,388 Q340L probably damaging Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr3 C T 9: 108,829,107 P930S probably damaging Het
Cox18 C T 5: 90,223,813 V43M probably damaging Het
Fam135b T C 15: 71,462,334 T1004A probably benign Het
Fam227a A G 15: 79,634,098 I335T possibly damaging Het
Gm14496 A G 2: 181,995,876 I248V probably benign Het
Gm4788 A G 1: 139,736,852 Y490H probably damaging Het
Gm5415 T A 1: 32,546,924 probably benign Het
Gm6871 T C 7: 41,545,682 T544A probably benign Het
Grm6 A T 11: 50,864,657 *872L probably null Het
Herc1 T A 9: 66,445,560 Y2109* probably null Het
Hsd11b2 T A 8: 105,519,103 V80E possibly damaging Het
Itgb3 T C 11: 104,665,496 V721A possibly damaging Het
Jade1 A T 3: 41,613,689 I731L probably benign Het
Khnyn G A 14: 55,887,590 V434I probably benign Het
Lrp1 A G 10: 127,589,619 L714P probably damaging Het
Lrrc41 G A 4: 116,094,888 E585K possibly damaging Het
Lrrfip1 A G 1: 91,076,951 Y70C probably damaging Het
Mex3a T A 3: 88,537,086 C490S probably damaging Het
Mmp27 C T 9: 7,578,984 R387C probably damaging Het
Mro A T 18: 73,877,506 D219V possibly damaging Het
Myot T A 18: 44,354,837 L407Q probably damaging Het
Nppa T A 4: 148,001,181 W82R probably damaging Het
Olfr243 T A 7: 103,717,325 C244S probably damaging Het
Olfr981 T G 9: 40,022,474 L27R probably damaging Het
Olfr994 T C 2: 85,429,974 N285S probably damaging Het
Phip T A 9: 82,890,126 I1123L possibly damaging Het
Ppip5k2 A G 1: 97,734,106 I695T probably benign Het
Ppp1r10 A T 17: 35,928,266 M347L probably benign Het
Reln A T 5: 21,899,084 C3296* probably null Het
Slf2 T A 19: 44,942,317 L611Q probably damaging Het
Spire1 G A 18: 67,501,181 Q396* probably null Het
Taf2 A G 15: 55,048,701 F537L probably damaging Het
Tbc1d16 C T 11: 119,156,072 E451K probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem267 T A 13: 119,609,238 V143E probably damaging Het
Tyw1 C T 5: 130,268,072 R177W possibly damaging Het
Vcp A T 4: 42,985,993 H340Q probably benign Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wnk4 A G 11: 101,268,356 D533G probably benign Het
Wwp1 A T 4: 19,650,174 C331S probably benign Het
Zik1 A T 7: 10,490,173 C332* probably null Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7680:Ctnna3 UTSW 10 64487550 missense probably benign
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8272:Ctnna3 UTSW 10 65002598 missense probably damaging 1.00
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTACGGTGGGTAAAACTGAAGC -3'
(R):5'- GTGTGCAGAAACCCCTAAAGTAC -3'

Sequencing Primer
(F):5'- ACTGAAGCACACTGTTGACTCTG -3'
(R):5'- GCACTGTACACTGTAGGTAGC -3'
Posted On2020-01-23