Incidental Mutation 'R8006:Spire1'
ID616654
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R8006 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 67501181 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 396 (Q396*)
Ref Sequence ENSEMBL: ENSMUSP00000049336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect probably null
Transcript: ENSMUST00000045105
AA Change: Q396*
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: Q396*

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082243
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115050
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224122
AA Change: Q96*
Predicted Effect probably benign
Transcript: ENSMUST00000224799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 40,795,907 H351Q probably benign Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Akap13 T C 7: 75,579,696 S126P probably damaging Het
Akip1 A G 7: 109,703,992 D14G probably damaging Het
Ankhd1 A G 18: 36,648,719 R287G Het
Ankrd13a A C 5: 114,804,423 *589S probably null Het
Ankrd34c T C 9: 89,729,836 I151V probably damaging Het
Ano5 T A 7: 51,593,770 D880E probably benign Het
Arl3 A C 19: 46,558,374 L4R probably damaging Het
Ate1 T A 7: 130,467,388 Q340L probably damaging Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr3 C T 9: 108,829,107 P930S probably damaging Het
Cox18 C T 5: 90,223,813 V43M probably damaging Het
Ctnna3 A G 10: 63,582,011 K176R probably benign Het
Fam135b T C 15: 71,462,334 T1004A probably benign Het
Fam227a A G 15: 79,634,098 I335T possibly damaging Het
Gm14496 A G 2: 181,995,876 I248V probably benign Het
Gm4788 A G 1: 139,736,852 Y490H probably damaging Het
Gm5415 T A 1: 32,546,924 probably benign Het
Gm6871 T C 7: 41,545,682 T544A probably benign Het
Grm6 A T 11: 50,864,657 *872L probably null Het
Herc1 T A 9: 66,445,560 Y2109* probably null Het
Hsd11b2 T A 8: 105,519,103 V80E possibly damaging Het
Itgb3 T C 11: 104,665,496 V721A possibly damaging Het
Jade1 A T 3: 41,613,689 I731L probably benign Het
Khnyn G A 14: 55,887,590 V434I probably benign Het
Lrp1 A G 10: 127,589,619 L714P probably damaging Het
Lrrc41 G A 4: 116,094,888 E585K possibly damaging Het
Lrrfip1 A G 1: 91,076,951 Y70C probably damaging Het
Mex3a T A 3: 88,537,086 C490S probably damaging Het
Mmp27 C T 9: 7,578,984 R387C probably damaging Het
Mro A T 18: 73,877,506 D219V possibly damaging Het
Myot T A 18: 44,354,837 L407Q probably damaging Het
Nppa T A 4: 148,001,181 W82R probably damaging Het
Olfr243 T A 7: 103,717,325 C244S probably damaging Het
Olfr981 T G 9: 40,022,474 L27R probably damaging Het
Olfr994 T C 2: 85,429,974 N285S probably damaging Het
Phip T A 9: 82,890,126 I1123L possibly damaging Het
Ppip5k2 A G 1: 97,734,106 I695T probably benign Het
Ppp1r10 A T 17: 35,928,266 M347L probably benign Het
Reln A T 5: 21,899,084 C3296* probably null Het
Slf2 T A 19: 44,942,317 L611Q probably damaging Het
Taf2 A G 15: 55,048,701 F537L probably damaging Het
Tbc1d16 C T 11: 119,156,072 E451K probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem267 T A 13: 119,609,238 V143E probably damaging Het
Tyw1 C T 5: 130,268,072 R177W possibly damaging Het
Vcp A T 4: 42,985,993 H340Q probably benign Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Wnk4 A G 11: 101,268,356 D533G probably benign Het
Wwp1 A T 4: 19,650,174 C331S probably benign Het
Zik1 A T 7: 10,490,173 C332* probably null Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 splice site probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
R8111:Spire1 UTSW 18 67519321 missense probably damaging 0.98
R8675:Spire1 UTSW 18 67491308 missense possibly damaging 0.48
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCAGAGTATAGTAGCTGAGGTATCAC -3'
(R):5'- GCCATGAACCATTGCCATCC -3'

Sequencing Primer
(F):5'- TAGCTGAGGTATCACTGTCAGAC -3'
(R):5'- CATCCTGTGGTTTCTGTTTTGC -3'
Posted On2020-01-23