Incidental Mutation 'R8007:Pappa2'
ID616662
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8007 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158782304 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1529 (I1529T)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect probably damaging
Transcript: ENSMUST00000159861
AA Change: I1529T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: I1529T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124316
Gene: ENSMUSG00000073530
AA Change: I201T

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
CCP 67 130 4.97e0 SMART
CCP 135 192 4.81e-1 SMART
CCP 196 245 2.84e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
R7575:Pappa2 UTSW 1 158814530 missense probably damaging 1.00
R7587:Pappa2 UTSW 1 158851131 missense probably damaging 1.00
R7826:Pappa2 UTSW 1 158936440 nonsense probably null
R8050:Pappa2 UTSW 1 158848400 missense probably damaging 1.00
R8063:Pappa2 UTSW 1 158936556 missense possibly damaging 0.79
R8068:Pappa2 UTSW 1 158935985 missense possibly damaging 0.87
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Z1176:Pappa2 UTSW 1 158814814 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158814816 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158956933 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATGGTTCGAGGCAAGGAG -3'
(R):5'- AGGGAGATTTTAGAGACGCTAC -3'

Sequencing Primer
(F):5'- CAAGGAGACCATGGGACCTAATAC -3'
(R):5'- GGAGATTTTAGAGACGCTACTCAAC -3'
Posted On2020-01-23