Incidental Mutation 'R8007:Ctss'
ID616671
Institutional Source Beutler Lab
Gene Symbol Ctss
Ensembl Gene ENSMUSG00000038642
Gene Namecathepsin S
SynonymsCat S
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R8007 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95526786-95556403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95550154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 309 (S309C)
Ref Sequence ENSEMBL: ENSMUSP00000015667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015667] [ENSMUST00000116304]
Predicted Effect probably null
Transcript: ENSMUST00000015667
AA Change: S309C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642
AA Change: S309C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116304
AA Change: S308C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642
AA Change: S308C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in Ctss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
clip UTSW 3 95545384 nonsense probably null
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R0033:Ctss UTSW 3 95545577 splice site probably benign
R1844:Ctss UTSW 3 95546794 critical splice acceptor site probably null
R2866:Ctss UTSW 3 95545406 missense probably benign 0.04
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R6555:Ctss UTSW 3 95543029 nonsense probably null
R7391:Ctss UTSW 3 95529541 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGTCATATCTCCAAGCATGT -3'
(R):5'- GCCCTAACACTGTCAAATGAAAC -3'

Sequencing Primer
(F):5'- GTTTTATTATCCTGAAACACTTGCC -3'
(R):5'- ACATCCTGATCTGCAAGTGG -3'
Posted On2020-01-23