Incidental Mutation 'R8007:Vmn2r14'
ID 616680
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission 046047-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R8007 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109368324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 223 (L223M)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: L223M

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: L223M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,647,845 (GRCm39) probably benign Het
A430033K04Rik T C 5: 138,644,901 (GRCm39) I262T probably benign Het
Acacb A G 5: 114,356,935 (GRCm39) R1289G probably damaging Het
Adgre4 A T 17: 56,121,233 (GRCm39) H433L probably damaging Het
Adgrv1 A G 13: 81,431,585 (GRCm39) F5948L probably benign Het
Adtrp A T 13: 41,969,707 (GRCm39) D97E probably damaging Het
Anapc5 T C 5: 122,929,963 (GRCm39) T543A probably benign Het
Ank2 G C 3: 126,730,096 (GRCm39) probably benign Het
Cacna2d4 C T 6: 119,289,405 (GRCm39) A813V probably benign Het
Cc2d2a T A 5: 43,863,442 (GRCm39) Y684N possibly damaging Het
Cenpf G A 1: 189,379,144 (GRCm39) P35L Het
Chtf18 A G 17: 25,944,508 (GRCm39) F281L probably damaging Het
Clstn1 T C 4: 149,716,305 (GRCm39) V257A probably damaging Het
Cnmd A T 14: 79,875,406 (GRCm39) V338E probably damaging Het
Col6a3 A C 1: 90,705,179 (GRCm39) F2848V unknown Het
Corin T C 5: 72,473,446 (GRCm39) S888G probably damaging Het
Ctss A T 3: 95,457,465 (GRCm39) S309C probably null Het
Dmxl2 G A 9: 54,290,975 (GRCm39) Q2492* probably null Het
Exoc7 C T 11: 116,197,465 (GRCm39) R12Q possibly damaging Het
F12 A G 13: 55,566,265 (GRCm39) I509T probably damaging Het
F13b A G 1: 139,434,680 (GRCm39) K149E probably benign Het
Fasn A G 11: 120,700,353 (GRCm39) I2159T probably benign Het
Fgfr2 A T 7: 129,765,719 (GRCm39) Y831* probably null Het
Foxp1 A T 6: 98,918,595 (GRCm39) S514R unknown Het
Gm11569 A G 11: 99,689,688 (GRCm39) S4P unknown Het
Gria4 T C 9: 4,503,740 (GRCm39) probably benign Het
Hnrnpul2 T A 19: 8,798,179 (GRCm39) probably null Het
Ibtk A T 9: 85,572,770 (GRCm39) D1257E probably benign Het
Ip6k2 T C 9: 108,682,955 (GRCm39) V355A probably benign Het
Kcnd2 G A 6: 21,217,073 (GRCm39) R259H probably damaging Het
Kcnj2 A C 11: 110,963,884 (GRCm39) E425D probably benign Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lgi2 C A 5: 52,723,375 (GRCm39) A25S probably benign Het
Lrp2 T C 2: 69,336,849 (GRCm39) T1308A probably benign Het
Ly6g2 A G 15: 75,088,552 (GRCm39) T7A probably benign Het
Matn2 A T 15: 34,426,315 (GRCm39) N609I probably benign Het
Mocs2 T A 13: 114,957,409 (GRCm39) S9T possibly damaging Het
Nebl T A 2: 17,375,300 (GRCm39) I102F Het
Nudt19 A G 7: 35,255,045 (GRCm39) V62A probably benign Het
Or10u4 T A 10: 129,801,744 (GRCm39) D269V possibly damaging Het
Or12k8 T A 2: 36,974,855 (GRCm39) R302W probably damaging Het
Or4a68 C T 2: 89,270,684 (GRCm39) Het
Or4k42 A T 2: 111,320,068 (GRCm39) V145E probably damaging Het
Pacrg A G 17: 11,058,919 (GRCm39) probably benign Het
Pappa2 A G 1: 158,609,874 (GRCm39) I1529T probably damaging Het
Pcdhga7 A T 18: 37,849,946 (GRCm39) H651L probably benign Het
Plch2 A G 4: 155,087,288 (GRCm39) L321P probably damaging Het
Ppargc1b A T 18: 61,443,565 (GRCm39) S549T possibly damaging Het
Rtel1 T A 2: 180,976,767 (GRCm39) N254K probably damaging Het
Rtl1 T C 12: 109,558,060 (GRCm39) N1260D possibly damaging Het
Samd7 T A 3: 30,812,531 (GRCm39) W324R probably damaging Het
Serpinb9e A G 13: 33,435,605 (GRCm39) I13V probably benign Het
Skint10 A G 4: 112,568,865 (GRCm39) L284S possibly damaging Het
Slc25a38 T A 9: 119,951,208 (GRCm39) I247K possibly damaging Het
Smarce1 G C 11: 99,115,876 (GRCm39) N48K possibly damaging Het
Stmn4 T G 14: 66,593,032 (GRCm39) probably benign Het
Stt3a G C 9: 36,653,065 (GRCm39) T539R probably damaging Het
Tab1 G A 15: 80,042,969 (GRCm39) V388I possibly damaging Het
Tcf12 G C 9: 71,841,905 (GRCm39) probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 (GRCm39) F23S probably damaging Het
Yae1d1 G A 13: 18,164,329 (GRCm39) S96L probably damaging Het
Zfp142 T C 1: 74,610,655 (GRCm39) I1047V probably benign Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109,369,222 (GRCm39) missense probably benign
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109,364,041 (GRCm39) missense probably damaging 1.00
R9774:Vmn2r14 UTSW 5 109,369,126 (GRCm39) missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCCATTGTGAGGTTGTGATCCAG -3'
(R):5'- CCATTTAATCCTAAACTGAGTGACC -3'

Sequencing Primer
(F):5'- CACCTTCTAAAGCTGACTTCTAGGG -3'
(R):5'- ACTGAGTGACCATGACCAGTTTC -3'
Posted On 2020-01-23