Incidental Mutation 'R8007:A430033K04Rik'
ID616683
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8007 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138646639 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 262 (I262T)
Ref Sequence ENSEMBL: ENSMUSP00000067316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect probably benign
Transcript: ENSMUST00000069862
AA Change: I262T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014
AA Change: I262T

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198958
AA Change: I262T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014
AA Change: I262T

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGTACTTTGGACCAGATGAAGCC -3'
(R):5'- TCCGTGAAGTTCTGGATCAACTG -3'

Sequencing Primer
(F):5'- TTGGACCAGATGAAGCCTTCCAC -3'
(R):5'- GATCAACTGTTTGCAGCTCGGC -3'
Posted On2020-01-23