Incidental Mutation 'R8007:Cacna2d4'
ID616686
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8007 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119312444 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 813 (A813V)
Ref Sequence ENSEMBL: ENSMUSP00000140197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000068351] [ENSMUST00000112756] [ENSMUST00000168793] [ENSMUST00000186622]
Predicted Effect probably benign
Transcript: ENSMUST00000037434
AA Change: A838V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: A838V

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068351
SMART Domains Protein: ENSMUSP00000063882
Gene: ENSMUSG00000055003

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112756
SMART Domains Protein: ENSMUSP00000108376
Gene: ENSMUSG00000055003

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168793
SMART Domains Protein: ENSMUSP00000126661
Gene: ENSMUSG00000055003

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186622
AA Change: A813V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: A813V

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,670,886 probably benign Het
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
Ank2 G C 3: 126,936,447 probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Gria4 T C 9: 4,503,740 probably benign Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stmn4 T G 14: 66,355,583 probably benign Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcf12 G C 9: 71,934,623 probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
Sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0612:Cacna2d4 UTSW 6 119281718 splice site probably benign
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0836:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2078:Cacna2d4 UTSW 6 119338116 missense probably benign 0.02
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 splice site probably null
R3976:Cacna2d4 UTSW 6 119278173 splice site probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R6931:Cacna2d4 UTSW 6 119282234 missense possibly damaging 0.49
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
R7363:Cacna2d4 UTSW 6 119343978 missense probably damaging 1.00
R7371:Cacna2d4 UTSW 6 119308709 missense probably benign 0.07
R7382:Cacna2d4 UTSW 6 119239087 missense probably damaging 1.00
R7431:Cacna2d4 UTSW 6 119244276 missense probably damaging 0.98
R7517:Cacna2d4 UTSW 6 119271921 missense probably benign 0.01
R7527:Cacna2d4 UTSW 6 119271247 missense probably benign 0.00
R7529:Cacna2d4 UTSW 6 119270766 missense probably benign 0.01
R7710:Cacna2d4 UTSW 6 119274239 missense probably benign 0.05
R7880:Cacna2d4 UTSW 6 119349155 missense probably damaging 0.99
R8084:Cacna2d4 UTSW 6 119300352 missense probably damaging 1.00
R8159:Cacna2d4 UTSW 6 119297527 missense probably benign 0.01
R8391:Cacna2d4 UTSW 6 119348745 missense probably benign 0.04
RF023:Cacna2d4 UTSW 6 119268230 missense probably benign 0.19
Z1176:Cacna2d4 UTSW 6 119312450 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATTTGTTCAGATGCAGGGACGG -3'
(R):5'- TGGGGATGAAATGGCCTCAG -3'

Sequencing Primer
(F):5'- TGGATAGCTGTAACCCATGAC -3'
(R):5'- TCAGGCCAGCTAGACAGG -3'
Posted On2020-01-23