Incidental Mutation 'R8007:Olfr819'
ID616694
Institutional Source Beutler Lab
Gene Symbol Olfr819
Ensembl Gene ENSMUSG00000094295
Gene Nameolfactory receptor 819
SynonymsGA_x6K02T2PULF-11644164-11643823, MOR265-2_p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8007 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129963011-129967266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129965875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 269 (D269V)
Ref Sequence ENSEMBL: ENSMUSP00000150514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167974] [ENSMUST00000216322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167974
AA Change: D275V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131761
Gene: ENSMUSG00000094295
AA Change: D275V

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.1e-55 PFAM
Pfam:7tm_1 47 296 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216322
AA Change: D269V

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in Olfr819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr819 APN 10 129965804 missense probably damaging 1.00
R2037:Olfr819 UTSW 10 129966140 missense probably benign 0.05
R2048:Olfr819 UTSW 10 129965992 missense probably damaging 1.00
R3687:Olfr819 UTSW 10 129966712 splice site probably null
R5249:Olfr819 UTSW 10 129966209 missense probably benign 0.06
R5445:Olfr819 UTSW 10 129966289 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTTACTGGATTATCAACACTTCAC -3'
(R):5'- AGCTTGTGTGGATACTTCCCAG -3'

Sequencing Primer
(F):5'- TATCAACACTTCACTAACAACATGTG -3'
(R):5'- GTGGATACTTCCCAGAATGAAATTG -3'
Posted On2020-01-23