Incidental Mutation 'R8007:BC025446'
ID 616709
Institutional Source Beutler Lab
Gene Symbol BC025446
Ensembl Gene ENSMUSG00000047728
Gene Name cDNA sequence BC025446
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8007 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 75216376-75222661 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75216703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 7 (T7A)
Ref Sequence ENSEMBL: ENSMUSP00000053396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055719] [ENSMUST00000185307] [ENSMUST00000229521]
AlphaFold A0A087WQT1
Predicted Effect probably benign
Transcript: ENSMUST00000055719
AA Change: T7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053396
Gene: ENSMUSG00000047728
AA Change: T7A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.06e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185307
AA Change: T7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140330
Gene: ENSMUSG00000047728
AA Change: T7A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 5.3e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229521
AA Change: T7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,670,886 probably benign Het
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
Ank2 G C 3: 126,936,447 probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Gria4 T C 9: 4,503,740 probably benign Het
Hnrnpul2 T A 19: 8,820,815 probably null Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stmn4 T G 14: 66,355,583 probably benign Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcf12 G C 9: 71,934,623 probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in BC025446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:BC025446 APN 15 75221656 utr 3 prime probably benign
R0084:BC025446 UTSW 15 75217775 missense probably benign 0.01
R0764:BC025446 UTSW 15 75220723 missense probably benign
R1736:BC025446 UTSW 15 75217720 missense probably damaging 1.00
R1829:BC025446 UTSW 15 75216756 critical splice donor site probably null
R5412:BC025446 UTSW 15 75217820 missense probably damaging 0.98
R5793:BC025446 UTSW 15 75221644 utr 3 prime probably benign
R7434:BC025446 UTSW 15 75216718 missense probably benign
R8479:BC025446 UTSW 15 75217777 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACAGACATGTATTCCTTGGTG -3'
(R):5'- TGTTGCAAAGCAGGGTCTGG -3'

Sequencing Primer
(F):5'- CAGACATGTATTCCTTGGTGAAAGC -3'
(R):5'- AGCACAGGAGGCTTCACC -3'
Posted On 2020-01-23