Incidental Mutation 'R8007:Hnrnpul2'
ID616717
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 2
Synonyms1110031M08Rik, Hnrpul2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R8007 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8819401-8834142 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 8820815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088092] [ENSMUST00000096751] [ENSMUST00000096753] [ENSMUST00000153281]
Predicted Effect probably benign
Transcript: ENSMUST00000088092
SMART Domains Protein: ENSMUSP00000085413
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096751
SMART Domains Protein: ENSMUSP00000094513
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096753
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153281
SMART Domains Protein: ENSMUSP00000120656
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
Pfam:TPR_11 6 93 1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,670,886 probably benign Het
A430033K04Rik T C 5: 138,646,639 I262T probably benign Het
Acacb A G 5: 114,218,874 R1289G probably damaging Het
Adgre4 A T 17: 55,814,233 H433L probably damaging Het
Adgrv1 A G 13: 81,283,466 F5948L probably benign Het
Adtrp A T 13: 41,816,231 D97E probably damaging Het
Anapc5 T C 5: 122,791,900 T543A probably benign Het
Ank2 G C 3: 126,936,447 probably benign Het
BC025446 A G 15: 75,216,703 T7A probably benign Het
Cacna2d4 C T 6: 119,312,444 A813V probably benign Het
Cc2d2a T A 5: 43,706,100 Y684N possibly damaging Het
Cenpf G A 1: 189,646,947 P35L Het
Chtf18 A G 17: 25,725,534 F281L probably damaging Het
Clstn1 T C 4: 149,631,848 V257A probably damaging Het
Cnmd A T 14: 79,637,966 V338E probably damaging Het
Col6a3 A C 1: 90,777,457 F2848V unknown Het
Corin T C 5: 72,316,103 S888G probably damaging Het
Ctss A T 3: 95,550,154 S309C probably null Het
Dmxl2 G A 9: 54,383,691 Q2492* probably null Het
Exoc7 C T 11: 116,306,639 R12Q possibly damaging Het
F12 A G 13: 55,418,452 I509T probably damaging Het
F13b A G 1: 139,506,942 K149E probably benign Het
Fasn A G 11: 120,809,527 I2159T probably benign Het
Fgfr2 A T 7: 130,163,989 Y831* probably null Het
Foxp1 A T 6: 98,941,634 S514R unknown Het
Gm11569 A G 11: 99,798,862 S4P unknown Het
Gria4 T C 9: 4,503,740 probably benign Het
Ibtk A T 9: 85,690,717 D1257E probably benign Het
Ip6k2 T C 9: 108,805,756 V355A probably benign Het
Kcnd2 G A 6: 21,217,074 R259H probably damaging Het
Kcnj2 A C 11: 111,073,058 E425D probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgi2 C A 5: 52,566,033 A25S probably benign Het
Lrp2 T C 2: 69,506,505 T1308A probably benign Het
Matn2 A T 15: 34,426,169 N609I probably benign Het
Mocs2 T A 13: 114,820,873 S9T possibly damaging Het
Nebl T A 2: 17,370,489 I102F Het
Nudt19 A G 7: 35,555,620 V62A probably benign Het
Olfr1240 C T 2: 89,440,340 Het
Olfr1290 A T 2: 111,489,723 V145E probably damaging Het
Olfr361 T A 2: 37,084,843 R302W probably damaging Het
Olfr819 T A 10: 129,965,875 D269V possibly damaging Het
Pacrg A G 17: 10,840,032 probably benign Het
Pappa2 A G 1: 158,782,304 I1529T probably damaging Het
Pcdhga7 A T 18: 37,716,893 H651L probably benign Het
Plch2 A G 4: 155,002,831 L321P probably damaging Het
Ppargc1b A T 18: 61,310,494 S549T possibly damaging Het
Rtel1 T A 2: 181,334,974 N254K probably damaging Het
Rtl1 T C 12: 109,591,626 N1260D possibly damaging Het
Samd7 T A 3: 30,758,382 W324R probably damaging Het
Serpinb9e A G 13: 33,251,622 I13V probably benign Het
Skint10 A G 4: 112,711,668 L284S possibly damaging Het
Slc25a38 T A 9: 120,122,142 I247K possibly damaging Het
Smarce1 G C 11: 99,225,050 N48K possibly damaging Het
Stmn4 T G 14: 66,355,583 probably benign Het
Stt3a G C 9: 36,741,769 T539R probably damaging Het
Tab1 G A 15: 80,158,768 V388I possibly damaging Het
Tcf12 G C 9: 71,934,623 probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trp53inp1 T C 4: 11,164,525 F23S probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Yae1d1 G A 13: 17,989,744 S96L probably damaging Het
Zfp142 T C 1: 74,571,496 I1047V probably benign Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8823628 missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8826801 missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8824413 missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8825052 missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8823237 missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8831332 missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8824438 nonsense probably null
R2226:Hnrnpul2 UTSW 19 8824985 missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8820637 missense probably benign
R3703:Hnrnpul2 UTSW 19 8824409 missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8823227 unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8822825 missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8820716 missense probably benign
R5435:Hnrnpul2 UTSW 19 8820318 missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8824891 missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8823232 missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8826717 missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8831509 missense unknown
R6978:Hnrnpul2 UTSW 19 8824276 missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8831309 missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8820630 missense probably benign
R7726:Hnrnpul2 UTSW 19 8831280 missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8820424 missense probably benign
R7753:Hnrnpul2 UTSW 19 8824972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGATGCTGAGATGCTGG -3'
(R):5'- CCCTCCTGCAAACAGTGTAAAG -3'

Sequencing Primer
(F):5'- CGCTGCTTGAGGACGAAGAC -3'
(R):5'- CCTTCAAAAAGATGGACAGCG -3'
Posted On2020-01-23