Incidental Mutation 'R8008:Wdr12'
ID616718
Institutional Source Beutler Lab
Gene Symbol Wdr12
Ensembl Gene ENSMUSG00000026019
Gene NameWD repeat domain 12
SynonymsYtm1p, 4933402C23Rik, Ytm1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60069785-60098645 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60089335 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 85 (Y85*)
Ref Sequence ENSEMBL: ENSMUSP00000027173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027173] [ENSMUST00000117438] [ENSMUST00000122038] [ENSMUST00000141417] [ENSMUST00000143342]
Predicted Effect probably null
Transcript: ENSMUST00000027173
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000027173
Gene: ENSMUSG00000026019
AA Change: Y85*

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117438
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000113494
Gene: ENSMUSG00000026019
AA Change: Y85*

DomainStartEndE-ValueType
Pfam:NLE 4 70 2e-19 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122038
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000113148
Gene: ENSMUSG00000026019
AA Change: Y85*

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141417
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000117747
Gene: ENSMUSG00000026019
AA Change: Y85*

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000143342
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000117391
Gene: ENSMUSG00000026019
AA Change: Y85*

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Wdr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Wdr12 APN 1 60080559 missense probably damaging 1.00
R0313:Wdr12 UTSW 1 60082579 missense possibly damaging 0.92
R0684:Wdr12 UTSW 1 60089366 splice site probably benign
R1157:Wdr12 UTSW 1 60078230 missense probably damaging 1.00
R1411:Wdr12 UTSW 1 60088072 missense probably benign 0.01
R1539:Wdr12 UTSW 1 60083848 splice site probably null
R2075:Wdr12 UTSW 1 60091063 missense possibly damaging 0.77
R3113:Wdr12 UTSW 1 60087062 missense probably benign 0.01
R4533:Wdr12 UTSW 1 60078195 missense probably benign 0.05
R5153:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R5196:Wdr12 UTSW 1 60087084 missense probably damaging 1.00
R6603:Wdr12 UTSW 1 60082624 missense probably damaging 1.00
R7310:Wdr12 UTSW 1 60082575 nonsense probably null
R7466:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R7621:Wdr12 UTSW 1 60097589 start gained probably benign
R7805:Wdr12 UTSW 1 60097594 start gained probably benign
R7846:Wdr12 UTSW 1 60082066 missense probably damaging 1.00
R7929:Wdr12 UTSW 1 60082066 missense probably damaging 1.00
Z1176:Wdr12 UTSW 1 60082564 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCCAATTTGGTGTGGCC -3'
(R):5'- GAGCATACTTAACATTTTAGCCAGTC -3'

Sequencing Primer
(F):5'- GTGTGGCCACCAACATACACAG -3'
(R):5'- TGTCAAGACAGGCCATTCTG -3'
Posted On2020-01-23