Incidental Mutation 'R8008:Ankar'
ID616719
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72666484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 789 (V789A)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053499
AA Change: V789A

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: V789A

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
AA Change: V788A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212573
AA Change: V571A

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGGCTGAAATGCTTTCTC -3'
(R):5'- TTGCCATACCATGAATGCTACTTC -3'

Sequencing Primer
(F):5'- AGTTTCTGTCAGTGGAAAAATGG -3'
(R):5'- CCATACCATGAATGCTACTTCAATAC -3'
Posted On2020-01-23