Incidental Mutation 'R8008:Wdr3'
ID616730
Institutional Source Beutler Lab
Gene Symbol Wdr3
Ensembl Gene ENSMUSG00000033285
Gene NameWD repeat domain 3
SynonymsD030020G18Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100138180-100162407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100154936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 221 (D221G)
Ref Sequence ENSEMBL: ENSMUSP00000060613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052120] [ENSMUST00000125059] [ENSMUST00000197602]
Predicted Effect probably benign
Transcript: ENSMUST00000052120
AA Change: D221G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060613
Gene: ENSMUSG00000033285
AA Change: D221G

DomainStartEndE-ValueType
Blast:WD40 12 51 3e-16 BLAST
WD40 54 93 3.14e-6 SMART
WD40 96 135 1.04e-6 SMART
WD40 138 177 1.15e-4 SMART
WD40 180 219 4.24e-3 SMART
low complexity region 225 239 N/A INTRINSIC
Blast:WD40 267 307 3e-18 BLAST
low complexity region 316 331 N/A INTRINSIC
WD40 403 441 8.49e-3 SMART
WD40 444 481 1.71e1 SMART
WD40 484 523 2.1e-7 SMART
WD40 538 576 1.2e-2 SMART
WD40 579 618 2.45e-8 SMART
WD40 621 660 5.47e-6 SMART
WD40 663 702 1.03e-10 SMART
low complexity region 711 724 N/A INTRINSIC
Pfam:Utp12 803 906 6.4e-25 PFAM
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125059
SMART Domains Protein: ENSMUSP00000135731
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146989
SMART Domains Protein: ENSMUSP00000134945
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197602
SMART Domains Protein: ENSMUSP00000143010
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Wdr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Wdr3 APN 3 100148108 missense probably damaging 1.00
IGL00706:Wdr3 APN 3 100148100 unclassified probably benign
IGL01391:Wdr3 APN 3 100146789 unclassified probably benign
IGL02008:Wdr3 APN 3 100150982 missense probably damaging 0.97
IGL02136:Wdr3 APN 3 100138725 nonsense probably null
IGL02215:Wdr3 APN 3 100146700 critical splice donor site probably null
IGL02505:Wdr3 APN 3 100151974 missense probably benign
IGL03412:Wdr3 APN 3 100151977 missense probably benign 0.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0369:Wdr3 UTSW 3 100156418 nonsense probably null
R0865:Wdr3 UTSW 3 100152796 unclassified probably benign
R0966:Wdr3 UTSW 3 100161069 missense probably damaging 0.99
R1168:Wdr3 UTSW 3 100142219 missense probably benign 0.11
R1612:Wdr3 UTSW 3 100151199 splice site probably benign
R1768:Wdr3 UTSW 3 100153870 missense probably benign
R2060:Wdr3 UTSW 3 100159897 unclassified probably null
R3793:Wdr3 UTSW 3 100151965 missense probably benign 0.02
R3888:Wdr3 UTSW 3 100153906 missense probably benign
R4410:Wdr3 UTSW 3 100140227 missense probably benign
R4596:Wdr3 UTSW 3 100152867 missense possibly damaging 0.95
R4609:Wdr3 UTSW 3 100140200 missense probably damaging 1.00
R4817:Wdr3 UTSW 3 100146545 missense possibly damaging 0.71
R5016:Wdr3 UTSW 3 100141620 intron probably benign
R5024:Wdr3 UTSW 3 100154936 missense probably benign
R5411:Wdr3 UTSW 3 100142984 missense probably damaging 1.00
R5430:Wdr3 UTSW 3 100157327 missense possibly damaging 0.88
R5902:Wdr3 UTSW 3 100144491 unclassified probably benign
R6177:Wdr3 UTSW 3 100161152 missense probably damaging 0.97
R6445:Wdr3 UTSW 3 100156403 missense possibly damaging 0.65
R6516:Wdr3 UTSW 3 100145676 missense probably damaging 1.00
R6624:Wdr3 UTSW 3 100144326 missense probably damaging 1.00
R6747:Wdr3 UTSW 3 100138724 missense probably damaging 1.00
R6813:Wdr3 UTSW 3 100138725 nonsense probably null
R6899:Wdr3 UTSW 3 100149901 missense possibly damaging 0.90
R7024:Wdr3 UTSW 3 100154997 missense probably benign 0.00
R7509:Wdr3 UTSW 3 100151187 missense probably benign 0.03
R8062:Wdr3 UTSW 3 100142494 missense probably benign
X0012:Wdr3 UTSW 3 100145630 splice site probably null
Z1088:Wdr3 UTSW 3 100144344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGACACCAGTGTAAGAACTCC -3'
(R):5'- TTATCTGAACAGGGCAGTAAGGAC -3'

Sequencing Primer
(F):5'- GACACCAGTGTAAGAACTCCTATTAC -3'
(R):5'- TCCCCTCAGGAAGAGTGGTTCTC -3'
Posted On2020-01-23