Incidental Mutation 'R8008:Coro2a'
ID616732
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Namecoronin, actin binding protein 2A
Synonymscoronin 4, IR10, 9030208C03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46536937-46602202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46551349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 119 (S119T)
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000107756] [ENSMUST00000107757]
Predicted Effect probably damaging
Transcript: ENSMUST00000030021
AA Change: S100T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337
AA Change: S100T

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107756
AA Change: S100T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337
AA Change: S100T

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107757
AA Change: S119T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337
AA Change: S119T

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46540455 missense probably benign 0.06
IGL03093:Coro2a APN 4 46544158 missense possibly damaging 0.93
R1562:Coro2a UTSW 4 46548917 missense probably benign 0.02
R1862:Coro2a UTSW 4 46548797 missense possibly damaging 0.93
R1931:Coro2a UTSW 4 46539138 makesense probably null
R4385:Coro2a UTSW 4 46541961 missense possibly damaging 0.93
R5171:Coro2a UTSW 4 46542372 intron probably benign
R5243:Coro2a UTSW 4 46545620 missense probably damaging 1.00
R5393:Coro2a UTSW 4 46542255 missense probably damaging 1.00
R5785:Coro2a UTSW 4 46564691 missense probably benign 0.03
R6014:Coro2a UTSW 4 46542261 missense probably damaging 1.00
R6184:Coro2a UTSW 4 46540504 missense probably benign
R6264:Coro2a UTSW 4 46562912 missense probably damaging 1.00
R6601:Coro2a UTSW 4 46543421 nonsense probably null
R6732:Coro2a UTSW 4 46551374 missense probably damaging 0.99
R6760:Coro2a UTSW 4 46540572 missense probably benign
R7499:Coro2a UTSW 4 46539188 missense probably benign 0.01
R7516:Coro2a UTSW 4 46562992 missense probably benign 0.12
R7567:Coro2a UTSW 4 46546674 missense probably damaging 0.99
R7816:Coro2a UTSW 4 46546809 missense probably benign 0.01
RF012:Coro2a UTSW 4 46542336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAGGCCCTTAGCAAGATGC -3'
(R):5'- GAGAGGCACTAAGGTCCATC -3'

Sequencing Primer
(F):5'- TTAGCAAGATGCCATGGATCC -3'
(R):5'- GAGGCACTAAGGTCCATCCTACC -3'
Posted On2020-01-23