Incidental Mutation 'R8008:Rragc'
ID616733
Institutional Source Beutler Lab
Gene Symbol Rragc
Ensembl Gene ENSMUSG00000028646
Gene NameRas-related GTP binding C
SynonymsTIB929, Gtr2, YGR163W
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location123917446-123936997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123935547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 352 (D352G)
Ref Sequence ENSEMBL: ENSMUSP00000030399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030399] [ENSMUST00000155757]
Predicted Effect probably damaging
Transcript: ENSMUST00000030399
AA Change: D352G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030399
Gene: ENSMUSG00000028646
AA Change: D352G

DomainStartEndE-ValueType
Pfam:Arf 55 234 5.1e-7 PFAM
Pfam:SRPRB 58 154 9.8e-7 PFAM
Pfam:Gtr1_RagA 62 288 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155757
SMART Domains Protein: ENSMUSP00000115232
Gene: ENSMUSG00000028646

DomainStartEndE-ValueType
Pfam:Arf 55 157 1.7e-6 PFAM
Pfam:SRPRB 58 156 6.3e-8 PFAM
Pfam:Gtr1_RagA 62 178 1.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTR/RAG GTP-binding protein family. The encoded protein is a monomeric guanine nucleotide-binding protein which forms a heterodimer with RRAGA and RRAGB and is primarily localized to the cytoplasm. The encoded protein promotes intracellular localization of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Rragc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Rragc APN 4 123919843 unclassified probably benign
IGL01067:Rragc APN 4 123929968 missense probably benign 0.12
IGL01843:Rragc APN 4 123921059 missense probably damaging 1.00
IGL02302:Rragc APN 4 123921086 missense possibly damaging 0.65
IGL02368:Rragc APN 4 123921111 missense probably benign 0.11
R0740:Rragc UTSW 4 123924763 missense probably damaging 1.00
R0988:Rragc UTSW 4 123924782 synonymous probably null
R4620:Rragc UTSW 4 123924829 missense probably damaging 0.98
R5169:Rragc UTSW 4 123935664 missense probably damaging 0.96
R5727:Rragc UTSW 4 123920035 missense possibly damaging 0.66
R5729:Rragc UTSW 4 123924852 missense possibly damaging 0.60
R5959:Rragc UTSW 4 123923974 missense probably damaging 1.00
R6197:Rragc UTSW 4 123917547 missense possibly damaging 0.90
R7860:Rragc UTSW 4 123929924 missense probably damaging 0.99
R7943:Rragc UTSW 4 123929924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCCTGACTTGAGGATTTAACAC -3'
(R):5'- AGGACTAAGCCAGCACTGAG -3'

Sequencing Primer
(F):5'- CCCACTTGATTTGTTAGATTACCAG -3'
(R):5'- AGCCTCCGCTGCTGAGAC -3'
Posted On2020-01-23