Incidental Mutation 'R8008:Nr0b2'
ID616735
Institutional Source Beutler Lab
Gene Symbol Nr0b2
Ensembl Gene ENSMUSG00000037583
Gene Namenuclear receptor subfamily 0, group B, member 2
SynonymsSHP-1, SHP, small heterodimer partner
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score218.009
Status Not validated
Chromosome4
Chromosomal Location133553376-133556536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133556028 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 192 (A192E)
Ref Sequence ENSEMBL: ENSMUSP00000039175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042706]
PDB Structure
Mouse SF-1 LBD [X-RAY DIFFRACTION]
Crystal Structure of SHP/EID1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042706
AA Change: A192E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039175
Gene: ENSMUSG00000037583
AA Change: A192E

DomainStartEndE-ValueType
HOLI 60 231 1.08e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family of proteins. The encoded orphan receptor lacks a DNA binding domain but modulates gene expression by interacting with other hormone receptors to competitively inhibit binding of coactivators while also acting as a transcriptional corepressor. The encoded receptor may regulate bile acid synthesis and sexual maturation in males. Homozygous knockout mice exhibit accumulation of bile acids, reduced levels of low density lipoprotein cholesterol (LDL-C), and in male mice, earlier testicular maturation. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and exhibit no major defects in cholesterol metabolism under normal conditions. Under high cholesterol and cholic acid or iodine-deficient diets, mice exhibit decreased lipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Nr0b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Nr0b2 UTSW 4 133553738 missense probably damaging 1.00
R0310:Nr0b2 UTSW 4 133555992 splice site probably null
R0403:Nr0b2 UTSW 4 133553759 missense probably damaging 1.00
R0759:Nr0b2 UTSW 4 133553738 missense probably damaging 1.00
R0987:Nr0b2 UTSW 4 133556192 missense probably benign 0.00
R1005:Nr0b2 UTSW 4 133553474 missense probably benign 0.23
R4824:Nr0b2 UTSW 4 133556023 missense probably damaging 1.00
R5281:Nr0b2 UTSW 4 133556024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGTGAGCCAATGCATGTAACTC -3'
(R):5'- AGTTGAGGGCTGCCTTTCAG -3'

Sequencing Primer
(F):5'- CTCATTAGTGAAGGATCGCCTCAG -3'
(R):5'- CTTCAAGGAGTTCAGTGATGTCAACG -3'
Posted On2020-01-23