Incidental Mutation 'R8008:Brpf1'
ID616739
Institutional Source Beutler Lab
Gene Symbol Brpf1
Ensembl Gene ENSMUSG00000001632
Gene Namebromodomain and PHD finger containing, 1
Synonyms4930540D11Rik, 4833438B11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113307137-113324860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113319089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 781 (V781A)
Ref Sequence ENSEMBL: ENSMUSP00000108744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626]
Predicted Effect probably benign
Transcript: ENSMUST00000113117
AA Change: V780A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632
AA Change: V780A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
AA Change: V781A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632
AA Change: V781A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
AA Change: V787A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632
AA Change: V787A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
AA Change: V780A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632
AA Change: V780A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203577
AA Change: V786A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632
AA Change: V786A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204198
AA Change: V781A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632
AA Change: V781A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204626
AA Change: V786A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632
AA Change: V786A

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain, PHD finger and chromo/Tudor-related Pro-Trp-Trp-Pro (PWWP) domain containing protein. The encoded protein is a component of the MOZ/MORF histone acetyltransferase complexes which function as a transcriptional regulators. This protein binds to the catalytic MYST domains of the MOZ and MORF proteins and may play a role in stimulating acetyltransferase and transcriptional activity of the complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality around E9.5 and disrupts histone acetylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Brpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Brpf1 APN 6 113316684 missense probably damaging 0.99
IGL00697:Brpf1 APN 6 113314986 missense probably damaging 1.00
IGL00823:Brpf1 APN 6 113321886 missense probably benign 0.01
IGL00951:Brpf1 APN 6 113322553 missense probably damaging 1.00
IGL01335:Brpf1 APN 6 113319337 missense probably damaging 0.99
IGL01565:Brpf1 APN 6 113316650 missense probably damaging 1.00
IGL02237:Brpf1 APN 6 113310375 missense probably damaging 1.00
R1484:Brpf1 UTSW 6 113315135 missense probably damaging 1.00
R1502:Brpf1 UTSW 6 113322420 missense probably damaging 1.00
R1517:Brpf1 UTSW 6 113319089 missense probably benign 0.17
R1525:Brpf1 UTSW 6 113317154 missense probably damaging 1.00
R1773:Brpf1 UTSW 6 113319931 missense possibly damaging 0.85
R1925:Brpf1 UTSW 6 113319930 missense probably damaging 0.96
R2928:Brpf1 UTSW 6 113322046 missense possibly damaging 0.95
R3900:Brpf1 UTSW 6 113318433 missense probably benign 0.20
R4019:Brpf1 UTSW 6 113310282 missense probably damaging 0.97
R4630:Brpf1 UTSW 6 113309906 missense probably damaging 1.00
R4754:Brpf1 UTSW 6 113320447 missense possibly damaging 0.92
R4757:Brpf1 UTSW 6 113315111 missense probably damaging 1.00
R4858:Brpf1 UTSW 6 113317678 missense possibly damaging 0.56
R4866:Brpf1 UTSW 6 113322470 missense probably damaging 0.97
R5073:Brpf1 UTSW 6 113310254 missense probably damaging 0.97
R5197:Brpf1 UTSW 6 113319941 missense possibly damaging 0.57
R7011:Brpf1 UTSW 6 113318466 missense probably benign 0.00
R7585:Brpf1 UTSW 6 113315046 missense possibly damaging 0.58
R7655:Brpf1 UTSW 6 113314874 missense probably benign 0.02
R7656:Brpf1 UTSW 6 113314874 missense probably benign 0.02
R7817:Brpf1 UTSW 6 113320539 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCACTCTACATACTAGTGCTGCTG -3'
(R):5'- CCATCTTTGTCACAGGCTGC -3'

Sequencing Primer
(F):5'- GTTTTAACAGCTGTTCTAGGAGAAGC -3'
(R):5'- TCAGATTGCCCCGACCTGAG -3'
Posted On2020-01-23