Incidental Mutation 'R8008:Trim21'
ID616745
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Nametripartite motif-containing 21
SynonymsSsa1, Ro52
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102557921-102565486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102559976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 280 (T280K)
Ref Sequence ENSEMBL: ENSMUSP00000033264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably benign
Transcript: ENSMUST00000033264
AA Change: T280K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: T280K

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098227
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106913
AA Change: T280K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: T280K

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217478
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102559598 missense probably damaging 1.00
IGL01729:Trim21 APN 7 102563893 missense probably damaging 0.97
IGL02680:Trim21 APN 7 102559663 missense probably benign 0.44
IGL03349:Trim21 APN 7 102563277 missense probably benign 0.00
R1508:Trim21 UTSW 7 102559576 missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102561898 nonsense probably null
R2904:Trim21 UTSW 7 102559971 missense probably benign 0.00
R4482:Trim21 UTSW 7 102563933 nonsense probably null
R5480:Trim21 UTSW 7 102559256 missense probably benign 0.05
R5606:Trim21 UTSW 7 102559606 missense probably damaging 0.99
R6130:Trim21 UTSW 7 102563291 missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6215:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6291:Trim21 UTSW 7 102564082 missense probably damaging 1.00
R6731:Trim21 UTSW 7 102559212 missense probably damaging 1.00
R7612:Trim21 UTSW 7 102559535 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTTCCTCTGACATGTGAG -3'
(R):5'- TTCCTGTGGACATTGAATGCATG -3'

Sequencing Primer
(F):5'- CTCTGACATGTGAGGAAACTTCATC -3'
(R):5'- GAGTTTAATTATTGAGCCGTCCATG -3'
Posted On2020-01-23