Incidental Mutation 'R8008:Nhsl1'
ID616751
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18408438 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 42 (D42E)
Ref Sequence ENSEMBL: ENSMUSP00000040799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: D42E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: D42E

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207038
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7299:Nhsl1 UTSW 10 18527671 splice site probably null
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
R7513:Nhsl1 UTSW 10 18523952 missense probably damaging 1.00
R7566:Nhsl1 UTSW 10 18516119 missense probably damaging 1.00
Z1177:Nhsl1 UTSW 10 18526589 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAAGGATCCCGGCCAATTC -3'
(R):5'- AATGGTACTTAGCTCCAGCAC -3'

Sequencing Primer
(F):5'- GGATCCCGGCCAATTCTAAAAAG -3'
(R):5'- CTGATGGAGCAGGAGAGGAC -3'
Posted On2020-01-23