Incidental Mutation 'R8008:Epn2'
ID616753
Institutional Source Beutler Lab
Gene Symbol Epn2
Ensembl Gene ENSMUSG00000001036
Gene Nameepsin 2
SynonymsIbp2, 9530051D10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location61517249-61579687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61546666 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 27 (A27T)
Ref Sequence ENSEMBL: ENSMUSP00000136950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001063] [ENSMUST00000108711] [ENSMUST00000108712] [ENSMUST00000108713] [ENSMUST00000146455] [ENSMUST00000147501] [ENSMUST00000178202] [ENSMUST00000179936]
Predicted Effect probably damaging
Transcript: ENSMUST00000001063
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001063
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108711
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104351
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 431 443 N/A INTRINSIC
low complexity region 475 499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108712
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104352
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 488 500 N/A INTRINSIC
low complexity region 532 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108713
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104353
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 437 449 N/A INTRINSIC
low complexity region 481 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146455
Predicted Effect probably damaging
Transcript: ENSMUST00000147501
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117389
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
Pfam:ENTH 17 80 2.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148956
SMART Domains Protein: ENSMUSP00000122514
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
SCOP:d1eyha_ 2 35 1e-9 SMART
PDB:1EDU|A 2 37 5e-8 PDB
UIM 152 171 6.29e-1 SMART
UIM 177 196 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153984
SMART Domains Protein: ENSMUSP00000122666
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
UIM 72 91 3.37e-1 SMART
UIM 109 128 2.48e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178202
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136553
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179936
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136950
Gene: ENSMUSG00000001036
AA Change: A27T

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 494 506 N/A INTRINSIC
low complexity region 538 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Epn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Epn2 APN 11 61523086 missense probably benign 0.00
IGL01582:Epn2 APN 11 61521869 missense probably benign 0.00
IGL02375:Epn2 APN 11 61519671 missense probably damaging 1.00
IGL03213:Epn2 APN 11 61519684 missense probably damaging 0.99
Ipanema UTSW 11 61519558 missense probably benign 0.00
R0400:Epn2 UTSW 11 61532696 splice site probably null
R0458:Epn2 UTSW 11 61546455 missense possibly damaging 0.89
R0471:Epn2 UTSW 11 61535308 missense probably damaging 1.00
R0833:Epn2 UTSW 11 61519491 missense probably benign 0.01
R0836:Epn2 UTSW 11 61519491 missense probably benign 0.01
R1418:Epn2 UTSW 11 61523086 missense probably benign 0.00
R1699:Epn2 UTSW 11 61523188 nonsense probably null
R1743:Epn2 UTSW 11 61546411 missense possibly damaging 0.92
R4039:Epn2 UTSW 11 61546522 missense probably damaging 1.00
R4696:Epn2 UTSW 11 61535303 missense probably damaging 1.00
R4752:Epn2 UTSW 11 61546371 missense probably damaging 1.00
R4913:Epn2 UTSW 11 61534576 critical splice donor site probably null
R6053:Epn2 UTSW 11 61546497 missense probably damaging 1.00
R6302:Epn2 UTSW 11 61546486 missense probably damaging 1.00
R6455:Epn2 UTSW 11 61533641 missense probably damaging 1.00
R6669:Epn2 UTSW 11 61519558 missense probably benign 0.00
R7032:Epn2 UTSW 11 61546702 missense probably damaging 1.00
R7439:Epn2 UTSW 11 61546848 start gained probably benign
Z1177:Epn2 UTSW 11 61546424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGATGTTCTCACGGCAC -3'
(R):5'- CTGCATTTCTGACACGGAAAC -3'

Sequencing Primer
(F):5'- CGCTCAGAACCTGTCTTGATAAGG -3'
(R):5'- TTCTGACACGGAAACTTCCTAGGG -3'
Posted On2020-01-23