Incidental Mutation 'R8008:Pmp22'
ID616754
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63158407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 159 (R159C)
Ref Sequence ENSEMBL: ENSMUSP00000018361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably damaging
Transcript: ENSMUST00000018361
AA Change: R159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217
AA Change: R159C

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108700
AA Change: R159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217
AA Change: R159C

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108701
AA Change: R159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217
AA Change: R159C

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108702
AA Change: R159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217
AA Change: R159C

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R0561:Pmp22 UTSW 11 63134424 missense probably damaging 1.00
R3858:Pmp22 UTSW 11 63134475 missense probably benign 0.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6574:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6575:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R7455:Pmp22 UTSW 11 63134513 synonymous probably null
R7599:Pmp22 UTSW 11 63158348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATCCCCGCAGTTACCTG -3'
(R):5'- ATTCAACACGAGGCTGACGG -3'

Sequencing Primer
(F):5'- GCTGTCTTTCTCCTCCCAGG -3'
(R):5'- ACACGAGGCTGACGGTCAAC -3'
Posted On2020-01-23