Incidental Mutation 'R8008:Nt5c1b'
ID616757
Institutional Source Beutler Lab
Gene Symbol Nt5c1b
Ensembl Gene ENSMUSG00000020622
Gene Name5'-nucleotidase, cytosolic IB
Synonyms4921514H13Rik, CN-IB
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location10369973-10390175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10375000 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 182 (D182G)
Ref Sequence ENSEMBL: ENSMUSP00000002456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000118657] [ENSMUST00000143739] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000219292] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000220611] [ENSMUST00000223534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002456
AA Change: D182G

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622
AA Change: D182G

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
AA Change: D180G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622
AA Change: D180G

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000123105
Gene: ENSMUSG00000020622
AA Change: D182G

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147323
AA Change: D182G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622
AA Change: D182G

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217944
AA Change: D240G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably damaging
Transcript: ENSMUST00000218026
AA Change: D182G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000218287
AA Change: D240G

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000218327
AA Change: D180G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000218339
AA Change: D180G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably damaging
Transcript: ENSMUST00000218417
AA Change: D240G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218551
AA Change: D182G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219049
AA Change: D182G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219292
AA Change: D182G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000219826
AA Change: D240G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably damaging
Transcript: ENSMUST00000220257
AA Change: D240G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000220611
AA Change: D182G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000223534
AA Change: D182G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic 5-prime nucleotidases, such as NT5C1B, catalyze production of adenosine, which regulates diverse physiologic processes (Sala-Newby and Newby, 2001 [PubMed 11690631]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Nt5c1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Nt5c1b APN 12 10374798 missense probably benign 0.00
IGL01737:Nt5c1b APN 12 10390108 missense possibly damaging 0.93
IGL02114:Nt5c1b APN 12 10375444 missense probably damaging 1.00
IGL02131:Nt5c1b APN 12 10375491 missense possibly damaging 0.75
IGL02135:Nt5c1b APN 12 10377194 missense probably damaging 1.00
IGL02871:Nt5c1b APN 12 10381325 missense probably damaging 1.00
IGL03003:Nt5c1b APN 12 10374910 missense possibly damaging 0.90
IGL03327:Nt5c1b APN 12 10374861 nonsense probably null
R0838:Nt5c1b UTSW 12 10375071 nonsense probably null
R1340:Nt5c1b UTSW 12 10377276 missense probably damaging 1.00
R1480:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R1599:Nt5c1b UTSW 12 10390024 missense probably damaging 1.00
R1674:Nt5c1b UTSW 12 10370055 start gained probably benign
R1691:Nt5c1b UTSW 12 10375537 missense possibly damaging 0.95
R2237:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10390108 missense probably damaging 1.00
R2239:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2260:Nt5c1b UTSW 12 10374965 missense probably damaging 1.00
R2424:Nt5c1b UTSW 12 10370072 missense probably damaging 1.00
R3607:Nt5c1b UTSW 12 10377236 missense probably damaging 1.00
R4276:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R4582:Nt5c1b UTSW 12 10390054 missense probably damaging 1.00
R4711:Nt5c1b UTSW 12 10370093 missense probably damaging 1.00
R4775:Nt5c1b UTSW 12 10375449 missense probably damaging 1.00
R5840:Nt5c1b UTSW 12 10377171 missense probably damaging 1.00
R5940:Nt5c1b UTSW 12 10375515 missense probably damaging 1.00
R6104:Nt5c1b UTSW 12 10372955 missense probably damaging 1.00
R6329:Nt5c1b UTSW 12 10372138 nonsense probably null
R6626:Nt5c1b UTSW 12 10374837 nonsense probably null
R6722:Nt5c1b UTSW 12 10372874 missense possibly damaging 0.48
R7424:Nt5c1b UTSW 12 10381391 splice site probably null
R7491:Nt5c1b UTSW 12 10374903 missense probably benign 0.00
R7714:Nt5c1b UTSW 12 10375472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACATCAGAGAAGTCCTCC -3'
(R):5'- AGATGTCCAGTAGGCCTCATC -3'

Sequencing Primer
(F):5'- TCAGAGAAGTCCTCCATTCAACAG -3'
(R):5'- AGTAGGCCTCATCCACCTC -3'
Posted On2020-01-23