Incidental Mutation 'R0677:Vmn2r23'
ID61676
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission 038862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0677 (G1)
Quality Score84
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123713451 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 429 (L429F)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: L429F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L429F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,970,952 L59* probably null Het
A630073D07Rik G A 6: 132,626,557 Q79* probably null Het
Apol8 A C 15: 77,749,851 I175S probably damaging Het
BC004004 T C 17: 29,298,664 F284S probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dchs1 G A 7: 105,764,984 R875C probably damaging Het
Depdc5 A C 5: 32,901,470 N261T probably damaging Het
Flrt1 A T 19: 7,096,179 C334* probably null Het
Galnt5 T A 2: 57,998,980 Y197* probably null Het
Gp5 A G 16: 30,308,375 S494P probably benign Het
Ifnlr1 T A 4: 135,705,634 D460E possibly damaging Het
Mrgpra4 C T 7: 47,980,980 S291N probably benign Het
Msh4 G A 3: 153,879,367 P367S possibly damaging Het
Myct1 G T 10: 5,604,261 V43F probably benign Het
Ndst2 G A 14: 20,729,579 R198W probably benign Het
Ogdhl A T 14: 32,339,925 H500L probably damaging Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr769 T A 10: 129,112,078 M116L probably damaging Het
Pkhd1 C T 1: 20,524,230 G1220S probably benign Het
Slc26a4 A G 12: 31,549,911 probably null Het
Sytl1 A T 4: 133,253,225 C551S possibly damaging Het
Uri1 T C 7: 37,965,500 N256D probably benign Het
Vmn2r114 T G 17: 23,310,594 D178A probably damaging Het
Washc2 T C 6: 116,244,616 L685P probably damaging Het
Wipi2 A T 5: 142,658,234 I124F probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAATGTGAACAAAATGGCAGCCTGA -3'
(R):5'- ACTGCATCAAATGTGGCTAAAATCCCT -3'

Sequencing Primer
(F):5'- ATGGCAGCCTGAGCACAC -3'
(R):5'- GCATCATGCACATATTGTTTTCTG -3'
Posted On2013-07-30