Mutagenetix > Incidental Mutation

Incidental Mutation 'R0677:Vmn2r23'

61676

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

038862-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R0677 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123713451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 429 (L429F)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: L429F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L429F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,970,952	L59*	probably null	Het
A630073D07Rik	G	A	6: 132,626,557	Q79*	probably null	Het
Apol8	A	C	15: 77,749,851	I175S	probably damaging	Het
BC004004	T	C	17: 29,298,664	F284S	probably damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dchs1	G	A	7: 105,764,984	R875C	probably damaging	Het
Depdc5	A	C	5: 32,901,470	N261T	probably damaging	Het
Flrt1	A	T	19: 7,096,179	C334*	probably null	Het
Galnt5	T	A	2: 57,998,980	Y197*	probably null	Het
Gp5	A	G	16: 30,308,375	S494P	probably benign	Het
Ifnlr1	T	A	4: 135,705,634	D460E	possibly damaging	Het
Mrgpra4	C	T	7: 47,980,980	S291N	probably benign	Het
Msh4	G	A	3: 153,879,367	P367S	possibly damaging	Het
Myct1	G	T	10: 5,604,261	V43F	probably benign	Het
Ndst2	G	A	14: 20,729,579	R198W	probably benign	Het
Ogdhl	A	T	14: 32,339,925	H500L	probably damaging	Het
Olfr593	C	T	7: 103,212,798	R302*	probably null	Het
Olfr769	T	A	10: 129,112,078	M116L	probably damaging	Het
Pkhd1	C	T	1: 20,524,230	G1220S	probably benign	Het
Slc26a4	A	G	12: 31,549,911		probably null	Het
Sytl1	A	T	4: 133,253,225	C551S	possibly damaging	Het
Uri1	T	C	7: 37,965,500	N256D	probably benign	Het
Vmn2r114	T	G	17: 23,310,594	D178A	probably damaging	Het
Washc2	T	C	6: 116,244,616	L685P	probably damaging	Het
Wipi2	A	T	5: 142,658,234	I124F	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAATGTGAACAAAATGGCAGCCTGA -3'
(R):5'- ACTGCATCAAATGTGGCTAAAATCCCT -3'

Sequencing Primer
(F):5'- ATGGCAGCCTGAGCACAC -3'
(R):5'- GCATCATGCACATATTGTTTTCTG -3'

Posted On

2013-07-30