Incidental Mutation 'R8008:Olfr178'
ID616765
Institutional Source Beutler Lab
Gene Symbol Olfr178
Ensembl Gene ENSMUSG00000044029
Gene Nameolfactory receptor 178
SynonymsGA_x54KRFPKG5P-55108059-55107100, MOR184-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58888308-58892063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58889888 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000145885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058564] [ENSMUST00000206523] [ENSMUST00000215032]
Predicted Effect probably benign
Transcript: ENSMUST00000058564
AA Change: T111A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049578
Gene: ENSMUSG00000044029
AA Change: T111A

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 262 4.4e-7 PFAM
Pfam:7tm_1 43 312 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206523
AA Change: T111A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215032
AA Change: T111A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Olfr178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr178 APN 16 58889685 missense probably damaging 0.97
IGL01964:Olfr178 APN 16 58889464 missense probably damaging 0.97
IGL02122:Olfr178 APN 16 58889771 missense probably benign
IGL02183:Olfr178 APN 16 58889821 missense probably benign 0.00
IGL03143:Olfr178 APN 16 58889461 missense probably damaging 1.00
R1566:Olfr178 UTSW 16 58889540 missense probably damaging 1.00
R2324:Olfr178 UTSW 16 58890140 missense probably benign
R2420:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2421:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2422:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R4256:Olfr178 UTSW 16 58889780 missense probably benign 0.21
R4374:Olfr178 UTSW 16 58889879 missense probably benign 0.13
R4502:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4503:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4662:Olfr178 UTSW 16 58889924 missense probably damaging 1.00
R4967:Olfr178 UTSW 16 58889594 missense possibly damaging 0.48
R5206:Olfr178 UTSW 16 58890018 missense probably damaging 0.99
R5285:Olfr178 UTSW 16 58890108 nonsense probably null
R5477:Olfr178 UTSW 16 58889744 missense probably benign 0.10
R5554:Olfr178 UTSW 16 58889806 missense possibly damaging 0.95
R5723:Olfr178 UTSW 16 58889613 nonsense probably null
R5725:Olfr178 UTSW 16 58889887 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889758 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889759 missense probably damaging 0.99
R7238:Olfr178 UTSW 16 58889889 missense probably damaging 1.00
R7554:Olfr178 UTSW 16 58889406 missense probably benign 0.27
R7577:Olfr178 UTSW 16 58889266 missense probably benign 0.22
R7787:Olfr178 UTSW 16 58889590 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGTACAGGAGAGTCTATACAGG -3'
(R):5'- ATGGAGCCTCGTCTCCATAC -3'

Sequencing Primer
(F):5'- TATCACAGAAGAAATGATCAATGCG -3'
(R):5'- ATACACCCATGTACATCTTTCTGGG -3'
Posted On2020-01-23