Incidental Mutation 'R8008:Stap2'
ID616772
Institutional Source Beutler Lab
Gene Symbol Stap2
Ensembl Gene ENSMUSG00000038781
Gene Namesignal transducing adaptor family member 2
SynonymsSTAP-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55997081-56005570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55997790 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 331 (M331L)
Ref Sequence ENSEMBL: ENSMUSP00000038130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably benign
Transcript: ENSMUST00000011733
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
AA Change: M331L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781
AA Change: M331L

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent abnormalities in most organs at the gross and histological level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr1475 T C 19: 13,479,806 T131A probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Stap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Stap2 APN 17 55997623 missense probably benign 0.00
IGL02087:Stap2 APN 17 56005473 missense probably damaging 1.00
IGL02876:Stap2 APN 17 55999961 missense probably benign 0.00
IGL03101:Stap2 APN 17 56002029 missense probably damaging 1.00
R0033:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R0345:Stap2 UTSW 17 56000097 missense probably damaging 0.98
R3405:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3406:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3929:Stap2 UTSW 17 56003156 missense probably damaging 1.00
R4210:Stap2 UTSW 17 55997827 nonsense probably null
R4543:Stap2 UTSW 17 55997604 critical splice donor site probably null
R4934:Stap2 UTSW 17 55997901 missense possibly damaging 0.69
R5748:Stap2 UTSW 17 56000475 splice site probably null
R6228:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R6617:Stap2 UTSW 17 55999746 missense probably benign
R7092:Stap2 UTSW 17 56002954 missense probably benign 0.00
R7665:Stap2 UTSW 17 55997909 missense probably benign 0.00
R7879:Stap2 UTSW 17 56002023 missense probably benign 0.45
R7962:Stap2 UTSW 17 56002023 missense probably benign 0.45
Z1088:Stap2 UTSW 17 55999748 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAACTGATGGCTTTGGGG -3'
(R):5'- GTGTATCTCAGTAGGTGCTCC -3'

Sequencing Primer
(F):5'- GGTTTTGCTGGGAGCCTTGC -3'
(R):5'- GTATCACATAGGCTCTGACAGTGAC -3'
Posted On2020-01-23