Incidental Mutation 'R8008:Olfr1475'
ID616777
Institutional Source Beutler Lab
Gene Symbol Olfr1475
Ensembl Gene ENSMUSG00000096708
Gene Nameolfactory receptor 1475
SynonymsGA_x6K02T2RE5P-3812807-3811863, MOR202-36
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8008 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13479252-13480196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13479806 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 131 (T131A)
Ref Sequence ENSEMBL: ENSMUSP00000079616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080801]
Predicted Effect probably benign
Transcript: ENSMUST00000080801
AA Change: T131A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079616
Gene: ENSMUSG00000096708
AA Change: T131A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.7e-9 PFAM
Pfam:7tm_1 39 288 1.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T A 17: 47,436,736 E28V probably damaging Het
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
Alpi A G 1: 87,098,662 S536P unknown Het
Ankar A G 1: 72,666,484 V789A possibly damaging Het
Atp5b C A 10: 128,083,408 Q28K unknown Het
Brpf1 T C 6: 113,319,089 V781A probably benign Het
Cd177 G A 7: 24,752,349 S414L not run Het
Clca3b T A 3: 144,844,609 T192S probably benign Het
Coro2a A T 4: 46,551,349 S119T probably damaging Het
Cpped1 T C 16: 11,828,396 N164S probably damaging Het
Crybg2 T A 4: 134,091,104 N1390K probably damaging Het
Epn2 C T 11: 61,546,666 A27T probably damaging Het
Esp34 T C 17: 38,559,599 F128S possibly damaging Het
Evpl T A 11: 116,230,472 N410Y probably null Het
Fam71d T A 12: 78,715,043 D160E probably benign Het
Flnb A G 14: 7,892,155 Y608C probably damaging Het
Fpr3 T C 17: 17,971,453 S329P probably benign Het
Frem2 T A 3: 53,652,910 N1392I probably damaging Het
Gm35339 G A 15: 76,360,632 E1125K Het
Gpi1 G T 7: 34,218,301 N249K probably damaging Het
Gpr87 T C 3: 59,180,045 N13S probably benign Het
Gys2 T C 6: 142,454,517 T323A probably damaging Het
Iqgap3 T C 3: 88,109,463 I1084T probably damaging Het
Lrfn4 C G 19: 4,613,537 G323A probably benign Het
Lrrc4c A T 2: 97,630,249 S407C possibly damaging Het
Map3k20 A T 2: 72,438,269 Q540L probably benign Het
Myom1 T C 17: 71,100,062 V1158A probably benign Het
Ncor2 T C 5: 125,067,919 D378G unknown Het
Nhsl1 T A 10: 18,408,438 D42E probably damaging Het
Nr0b2 C A 4: 133,556,028 A192E probably benign Het
Nt5c1b A G 12: 10,375,000 D182G possibly damaging Het
Olfr104-ps T C 17: 37,362,374 S86P probably damaging Het
Olfr1220 A T 2: 89,097,715 C71S probably benign Het
Olfr178 T C 16: 58,889,888 T111A probably benign Het
Olfr874 A T 9: 37,746,793 I220F probably damaging Het
Pepd A G 7: 35,021,701 N250S probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Pmp22 C T 11: 63,158,407 R159C probably damaging Het
Pou3f1 C T 4: 124,658,971 A422V unknown Het
Rab11fip3 A G 17: 26,067,982 L399P probably damaging Het
Rragc A G 4: 123,935,547 D352G probably damaging Het
Ryr2 A G 13: 11,657,094 V3420A probably benign Het
Sez6 T A 11: 77,973,256 Y521* probably null Het
Smc4 T C 3: 69,007,312 V86A probably damaging Het
Stap2 T A 17: 55,997,790 M331L probably benign Het
Syt8 G A 7: 142,438,522 R89H probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim21 G T 7: 102,559,976 T280K probably benign Het
Trim36 C A 18: 46,172,489 V476F probably benign Het
Troap G T 15: 99,075,630 R56L probably benign Het
Ttn A T 2: 76,836,786 I11492K unknown Het
Tuft1 T C 3: 94,614,133 T390A probably damaging Het
Ucp1 T C 8: 83,294,011 I150T probably benign Het
Usp17lb A T 7: 104,841,274 C149S possibly damaging Het
Vmn1r159 A T 7: 22,843,240 N122K possibly damaging Het
Vmn1r237 T C 17: 21,314,194 C60R probably damaging Het
Wdr12 A T 1: 60,089,335 Y85* probably null Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan T C 5: 137,405,362 E3974G unknown Het
Other mutations in Olfr1475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr1475 APN 19 13479787 missense possibly damaging 0.81
IGL01604:Olfr1475 APN 19 13479248 unclassified probably benign
IGL01656:Olfr1475 APN 19 13480090 missense probably benign 0.08
IGL01802:Olfr1475 APN 19 13479365 missense probably benign 0.05
IGL01839:Olfr1475 APN 19 13479440 missense probably benign
IGL02255:Olfr1475 APN 19 13479985 missense probably damaging 1.00
IGL02706:Olfr1475 APN 19 13480098 nonsense probably null
IGL02723:Olfr1475 APN 19 13479335 missense probably damaging 1.00
IGL03143:Olfr1475 APN 19 13479471 missense probably damaging 1.00
IGL03174:Olfr1475 APN 19 13480069 missense probably benign 0.10
R0442:Olfr1475 UTSW 19 13480048 missense probably damaging 1.00
R0490:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R0491:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R1757:Olfr1475 UTSW 19 13479607 missense possibly damaging 0.67
R1843:Olfr1475 UTSW 19 13479931 missense probably benign 0.00
R1972:Olfr1475 UTSW 19 13479694 missense probably benign 0.00
R2137:Olfr1475 UTSW 19 13479809 missense probably damaging 1.00
R3150:Olfr1475 UTSW 19 13479460 missense probably damaging 1.00
R3858:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3859:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3953:Olfr1475 UTSW 19 13479442 missense probably benign 0.43
R4611:Olfr1475 UTSW 19 13480012 missense probably damaging 0.96
R4934:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R5580:Olfr1475 UTSW 19 13479427 missense probably damaging 1.00
R6278:Olfr1475 UTSW 19 13479755 missense probably benign
R6444:Olfr1475 UTSW 19 13479430 missense possibly damaging 0.95
R6796:Olfr1475 UTSW 19 13479914 missense probably damaging 1.00
R6812:Olfr1475 UTSW 19 13479611 missense probably benign 0.03
R7608:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R7632:Olfr1475 UTSW 19 13479431 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCACAAGTACCCAAGATAAGGACTG -3'
(R):5'- GTGTTTATGCCTCAGCTGTCAC -3'

Sequencing Primer
(F):5'- GTACCCAAGATAAGGACTGTAATCTC -3'
(R):5'- CTGTCACTCCCAAGGTGATGGAAG -3'
Posted On2020-01-23