Incidental Mutation 'R8009:Golm2'
ID 616785
Institutional Source Beutler Lab
Gene Symbol Golm2
Ensembl Gene ENSMUSG00000060227
Gene Name golgi membrane protein 2
Synonyms D130060C09Rik, Casc4
MMRRC Submission 046049-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8009 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121697451-121766701 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121737242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000077811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078752] [ENSMUST00000089912] [ENSMUST00000089915] [ENSMUST00000110586] [ENSMUST00000136023]
AlphaFold Q6P2L7
Predicted Effect probably benign
Transcript: ENSMUST00000078752
AA Change: V261A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077811
Gene: ENSMUSG00000060227
AA Change: V261A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089912
AA Change: V261A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087357
Gene: ENSMUSG00000060227
AA Change: V261A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089915
AA Change: V261A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087360
Gene: ENSMUSG00000060227
AA Change: V261A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110586
AA Change: V261A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106216
Gene: ENSMUSG00000060227
AA Change: V261A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136023
AA Change: V149A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117883
Gene: ENSMUSG00000060227
AA Change: V149A

DomainStartEndE-ValueType
coiled coil region 2 83 N/A INTRINSIC
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The increased expression level of this gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. Alternatively spliced variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Baz1a A T 12: 54,941,816 (GRCm39) Y1466* probably null Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Esyt1 T C 10: 128,347,354 (GRCm39) E1057G probably benign Het
Fsip2 A G 2: 82,818,793 (GRCm39) E4842G possibly damaging Het
Gadd45b G A 10: 80,766,984 (GRCm39) V90I probably benign Het
Gfi1 T A 5: 107,871,667 (GRCm39) H79L probably damaging Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Itsn2 G A 12: 4,714,553 (GRCm39) A950T probably benign Het
Kcna5 A G 6: 126,510,517 (GRCm39) L537P probably benign Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Lrch3 A T 16: 32,826,083 (GRCm39) D720V possibly damaging Het
Lrrk1 T C 7: 65,915,222 (GRCm39) D1622G possibly damaging Het
Meioc G C 11: 102,567,569 (GRCm39) A788P probably damaging Het
Mmp1a A T 9: 7,467,236 (GRCm39) T271S possibly damaging Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or14j5 A T 17: 38,161,693 (GRCm39) D70V probably damaging Het
Or8k39 A G 2: 86,563,848 (GRCm39) L36P probably damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Phactr3 A C 2: 177,974,737 (GRCm39) R523S probably damaging Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Prkcg A G 7: 3,362,708 (GRCm39) D294G probably benign Het
Psg28 T A 7: 18,156,922 (GRCm39) I438L probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Rps6ka5 T C 12: 100,544,048 (GRCm39) E350G probably damaging Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgce T C 6: 4,691,636 (GRCm39) D313G probably damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Stxbp5 A G 10: 9,692,046 (GRCm39) V366A probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tlr3 G A 8: 45,853,819 (GRCm39) T167M not run Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tmprss15 C T 16: 78,887,751 (GRCm39) V19M probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Ubqln3 T A 7: 103,791,797 (GRCm39) I98L probably benign Het
Uso1 A T 5: 92,314,439 (GRCm39) E115D probably benign Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Other mutations in Golm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Golm2 APN 2 121,741,274 (GRCm39) splice site probably benign
IGL01020:Golm2 APN 2 121,756,203 (GRCm39) missense probably benign 0.06
IGL01794:Golm2 APN 2 121,742,407 (GRCm39) missense probably benign 0.36
IGL02429:Golm2 APN 2 121,742,468 (GRCm39) missense probably benign 0.00
R0126:Golm2 UTSW 2 121,736,565 (GRCm39) splice site probably benign
R0709:Golm2 UTSW 2 121,697,906 (GRCm39) missense probably damaging 1.00
R2182:Golm2 UTSW 2 121,697,909 (GRCm39) missense probably damaging 1.00
R4771:Golm2 UTSW 2 121,756,126 (GRCm39) missense probably damaging 1.00
R5533:Golm2 UTSW 2 121,756,178 (GRCm39) intron probably benign
R5817:Golm2 UTSW 2 121,736,525 (GRCm39) missense probably benign 0.30
R6519:Golm2 UTSW 2 121,737,218 (GRCm39) missense probably benign 0.31
R6598:Golm2 UTSW 2 121,763,967 (GRCm39) missense probably damaging 1.00
R6598:Golm2 UTSW 2 121,763,966 (GRCm39) missense probably damaging 1.00
R7799:Golm2 UTSW 2 121,764,022 (GRCm39) missense probably benign 0.01
R8359:Golm2 UTSW 2 121,697,632 (GRCm39) start gained probably benign
R8360:Golm2 UTSW 2 121,697,632 (GRCm39) start gained probably benign
R8995:Golm2 UTSW 2 121,756,199 (GRCm39) missense probably damaging 1.00
R9095:Golm2 UTSW 2 121,756,096 (GRCm39) missense probably damaging 1.00
R9620:Golm2 UTSW 2 121,737,242 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGTTCACTTACAATCTGTGAC -3'
(R):5'- TGGCAATTAATGAGCTGCACC -3'

Sequencing Primer
(F):5'- TGTTCACTTACAATCTGTGACATTAG -3'
(R):5'- CAGAGAATGGTGGTGCTCC -3'
Posted On 2020-01-23